ID: 1132215708

View in Genome Browser
Species Human (GRCh38)
Location 15:100060263-100060285
Sequence CTCAACAGTTAGACTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132215704_1132215708 22 Left 1132215704 15:100060218-100060240 CCAAAACATAACTATGCTCACTT 0: 1
1: 0
2: 1
3: 17
4: 209
Right 1132215708 15:100060263-100060285 CTCAACAGTTAGACTTCTGTGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132215703_1132215708 23 Left 1132215703 15:100060217-100060239 CCCAAAACATAACTATGCTCACT 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1132215708 15:100060263-100060285 CTCAACAGTTAGACTTCTGTGGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132215708 Original CRISPR CTCAACAGTTAGACTTCTGT GGG Intronic
904510136 1:30998270-30998292 CTCAGAAGTCAGACTTCTGCTGG - Intronic
913696625 1:121332609-121332631 CACAACAGTCAGATTTCTTTTGG + Intronic
914140935 1:144947451-144947473 CACAACAGTCAGATTTCTTTTGG - Intronic
918191673 1:182181487-182181509 CTCAACAGTGAGATGTTTGTGGG + Intergenic
920483954 1:206350963-206350985 CACAACAGTCAGATTTCTTTTGG + Intronic
921806511 1:219461544-219461566 CTCAAGAGTTACACTTTAGTGGG + Intergenic
923828108 1:237522478-237522500 CTCAACAATTTTACTTCTATAGG + Intronic
1064390540 10:14938201-14938223 CTCAAAAGTCAGCCTGCTGTCGG + Intronic
1067706885 10:48612732-48612754 GGCATCAGTTAGAATTCTGTGGG - Intronic
1067991226 10:51214892-51214914 GTCAAGAGTGAGTCTTCTGTGGG - Intronic
1069179821 10:65344384-65344406 CTTAACAGTGTGACTTCAGTTGG - Intergenic
1071730418 10:88243016-88243038 CTCCACAGTTAGACTTCAAGCGG + Intergenic
1072930947 10:99661317-99661339 AAGAACATTTAGACTTCTGTTGG + Intronic
1073764357 10:106665811-106665833 GTCAAATGTTACACTTCTGTGGG + Intronic
1081806995 11:45896283-45896305 CTCATCAGAGAGGCTTCTGTGGG - Intronic
1083136448 11:60681604-60681626 CTCAACATTTAGACTTCTTTGGG - Intergenic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1088899821 11:114106994-114107016 TTCAACAGTTAGACTTGGGAAGG + Intronic
1089645930 11:119878952-119878974 TTCAACAGTCATAATTCTGTTGG - Intergenic
1090495373 11:127206352-127206374 CTCAGTAGTTCCACTTCTGTGGG + Intergenic
1091988554 12:4935316-4935338 ATCAACAGCTGGGCTTCTGTAGG - Intergenic
1093396980 12:18694486-18694508 CTCCACAATTAGGCTTTTGTAGG - Intronic
1096777140 12:53971197-53971219 CTGAAGTGTGAGACTTCTGTTGG - Intergenic
1098638995 12:72817538-72817560 CTCATTAGTTAGAATTCTGAAGG - Intergenic
1105028991 12:132869486-132869508 CTCAGTAGTGAGATTTCTGTAGG - Intronic
1110902995 13:80847273-80847295 GTCAACAATTAGATTTGTGTGGG + Intergenic
1113814201 13:113160209-113160231 CTCATTATTTAGACTTCTGCTGG + Intronic
1115501755 14:34056284-34056306 CTTAGTTGTTAGACTTCTGTAGG + Intronic
1116099833 14:40419717-40419739 CTCAACAGTTATAACTCTTTGGG + Intergenic
1116655961 14:47654321-47654343 CTTAACAGGGAGACTTCTGTAGG - Intronic
1117316228 14:54573425-54573447 CTCTAGAATTAGACTTCTGTAGG - Intronic
1121836298 14:97095656-97095678 CTCATCAGGAAGACTTCTTTTGG - Intergenic
1125092986 15:35816589-35816611 CTCAAAAGATGGACTTCAGTTGG + Intergenic
1129348977 15:74943051-74943073 CACAACAGCTGGACTTCTGATGG + Intergenic
1129556836 15:76518943-76518965 CTCTAAAGTTAGAATTCAGTGGG - Intronic
1131806945 15:96132535-96132557 CTCACCTGTTGGACTTCTCTAGG + Intergenic
1132215708 15:100060263-100060285 CTCAACAGTTAGACTTCTGTGGG + Intronic
1134136313 16:11678546-11678568 CTCATCAGTTTCACTTCTGGAGG + Exonic
1149252056 17:54781498-54781520 CTCTTCAGTTAGACTGATGTGGG - Intergenic
1151730863 17:75910362-75910384 CTCCACAGGTAGACTGTTGTGGG - Intronic
1153664818 18:7359459-7359481 CTCAAATTTGAGACTTCTGTGGG + Intergenic
1154292181 18:13118206-13118228 CTTAATAGTTAGGGTTCTGTTGG + Intronic
1161518897 19:4712781-4712803 CTCCACAGACAGACTTGTGTGGG - Intronic
1162407911 19:10486651-10486673 CTCAACAGGTACAGTTCTGCTGG + Exonic
928245992 2:29627373-29627395 ATCAACAGTGAGCCTTATGTTGG - Intronic
935034440 2:99355103-99355125 CTAAATGGTTATACTTCTGTGGG + Intronic
935109729 2:100081480-100081502 CTCAACAGAAGGTCTTCTGTTGG - Intronic
935391302 2:102555958-102555980 CTAACCAGTTAGGTTTCTGTAGG + Intergenic
936125245 2:109783729-109783751 CTCAACAGAAGGTCTTCTGTTGG + Intergenic
936219448 2:110587739-110587761 CTCAACAGAAGGTCTTCTGTTGG - Intergenic
942676003 2:178427557-178427579 CTCAACATTTTGATATCTGTTGG - Intergenic
942851595 2:180494342-180494364 CTCAGCAGCTAGTCTTATGTGGG + Intergenic
944026212 2:195171521-195171543 ATCAACATTTAGATTTCTGATGG + Intergenic
944630694 2:201620896-201620918 CTCAAAAGATAGAGTTCTTTAGG + Exonic
945017854 2:205538409-205538431 CTCAAGAATTAGACTTCTCTAGG + Intronic
945761755 2:213923264-213923286 CCCAGCAGTTCCACTTCTGTGGG - Intronic
1169358941 20:4931380-4931402 CTCAACAGTAAGACATTTGAGGG - Intronic
1177489462 21:21803770-21803792 TTCAGCAGTTAGACTTCTTAAGG - Intergenic
1179204189 21:39258848-39258870 CTCTACAGGAAGACTTTTGTTGG - Intronic
954540400 3:51389921-51389943 CTCAACTGTTAGACTAATCTAGG - Intergenic
958167463 3:89895518-89895540 CAGAACAGTTTGACTTCTATAGG - Intergenic
960474756 3:118110272-118110294 CACAACTGGAAGACTTCTGTTGG + Intergenic
960954319 3:123021075-123021097 CTCTACACTTAGACTCCTGATGG + Intronic
961260013 3:125594968-125594990 CTCAAAAGTTTAACTTCTGTGGG - Exonic
963664098 3:148160186-148160208 CTCAGCATTTAGACTTCTAGAGG - Intergenic
963970700 3:151426369-151426391 CTCAGTAGTGAGGCTTCTGTAGG + Intronic
971681897 4:29710747-29710769 GTCAGGAGCTAGACTTCTGTTGG + Intergenic
973663180 4:53129381-53129403 CTAAAAAGTCAGGCTTCTGTGGG + Intronic
974061296 4:57038389-57038411 GTCAAGAGTTAGAGTTCTGATGG + Intronic
976728582 4:88240446-88240468 CTCAGCACTAAGACTTGTGTAGG + Intergenic
977774176 4:100897677-100897699 CTCAACCATTAGTCTTCTCTGGG - Intergenic
983644230 4:169973430-169973452 CTCAATAATTAGTCTTCTGTTGG - Intergenic
985371307 4:189288333-189288355 GTCATCAGTAAGCCTTCTGTTGG - Intergenic
987849191 5:23326738-23326760 CTCAGCTGTAAGACTCCTGTGGG - Intergenic
991656763 5:68912025-68912047 CTCCACAGCTGGACTTCTGTCGG + Intergenic
993318748 5:86445392-86445414 CTCAAGAGTTACAGTTATGTAGG + Intergenic
994517816 5:100793510-100793532 CTCAAGAGTCAGACTCCAGTTGG - Intergenic
998306042 5:141078186-141078208 CCGCACAGTTAGACATCTGTTGG - Intergenic
1000130036 5:158288308-158288330 CTCATCAGTTAGATGTCTGAGGG - Intergenic
1001784189 5:174397513-174397535 CTCAACAGATAAACTTCAGAAGG - Intergenic
1005308954 6:24540982-24541004 ATCAATAGTTAGATTTGTGTAGG + Intergenic
1009619105 6:66049252-66049274 CTCAAGAGTTAGACTTAGGATGG - Intergenic
1012346478 6:98193703-98193725 TTCATCAGTTAGATTTGTGTTGG + Intergenic
1013772710 6:113645519-113645541 ATCACAAGTTAGACTTCTGCTGG - Intergenic
1014028585 6:116676374-116676396 CTCAACAGTGACAATTCTGAAGG + Intergenic
1016707963 6:147135559-147135581 CTGAACAGTTAGACTGTGGTTGG - Intergenic
1026432834 7:70364938-70364960 CTCAGCAGTAATACTGCTGTAGG + Intronic
1027929596 7:84514888-84514910 ATCAACACTTACAGTTCTGTGGG + Intergenic
1028715716 7:93965162-93965184 ATCAACATTTAGGCTTCTGGAGG - Intronic
1030233849 7:107237181-107237203 TTCCACAGTCAGAATTCTGTTGG - Intronic
1030896633 7:115069230-115069252 CTGAAGGCTTAGACTTCTGTAGG - Intergenic
1031588672 7:123563777-123563799 CTCATCATTTAGCCTCCTGTAGG - Intergenic
1031648548 7:124257206-124257228 CTAAACAGTTATATTTCAGTGGG + Intergenic
1032821634 7:135529400-135529422 TTCTACAGGTAGACTTCTTTTGG - Intergenic
1034504836 7:151480244-151480266 ATCAACAGTTAGACTGTTGCTGG - Intronic
1038084982 8:24186156-24186178 CACAAAATTTAGACTTCTTTTGG + Intergenic
1038836956 8:31136318-31136340 CTAAGCAGGTATACTTCTGTGGG - Intronic
1042610682 8:70596884-70596906 CATAAAAGTTATACTTCTGTGGG - Intronic
1047433121 8:124809781-124809803 CTCAACCATGAGGCTTCTGTGGG - Intergenic
1048252590 8:132878965-132878987 CTCAGTAGTTTGACTTCTTTTGG + Intronic
1052738868 9:32374369-32374391 ATCAACAGCTTGATTTCTGTAGG + Intergenic
1052775127 9:32725641-32725663 CTCAACACTAAGACTCCTCTTGG - Intergenic
1058604049 9:106701942-106701964 CTCAACAATAAACCTTCTGTTGG + Intergenic
1059986833 9:119828383-119828405 CTCAACATTTACAACTCTGTGGG + Intergenic
1192004764 X:67198582-67198604 CTCAACAGTCAGTCTCCAGTAGG - Intergenic
1193637013 X:83963557-83963579 GTCCACTGTTAGACTTTTGTAGG + Intergenic
1195760891 X:108245273-108245295 CACAGCAGTGAGCCTTCTGTTGG - Intronic
1201537401 Y:15065943-15065965 CTCAAAAGTTAGATTTCTGGCGG - Intergenic