ID: 1132215711

View in Genome Browser
Species Human (GRCh38)
Location 15:100060275-100060297
Sequence ACTTCTGTGGGGCACCACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132215711 Original CRISPR ACTTCTGTGGGGCACCACAC GGG Intronic
900887109 1:5423003-5423025 ACTCCTGTGAGGCAGCACACCGG + Intergenic
905481344 1:38264121-38264143 ACTTCTGTTAGACTCCACACTGG + Intergenic
906617831 1:47246857-47246879 ACTTCTGTGGGGCTTAGCACAGG + Intergenic
914834007 1:151192138-151192160 ACAGCTGTGAGCCACCACACTGG + Intronic
915633555 1:157171017-157171039 ACATCTGCCGGGCACCTCACTGG + Intergenic
918801346 1:188976136-188976158 ACAGGTGTGGGCCACCACACCGG + Intergenic
919749129 1:201025667-201025689 ACTTCTCTGGGGCCCAACTCTGG + Intergenic
920398881 1:205664841-205664863 GCTGCTGTGGGGCACCTCAGTGG + Exonic
1062877795 10:956014-956036 ACCTCTGTGGGGCACCTGGCAGG - Intergenic
1064517718 10:16168800-16168822 ACTTCTGTAAGGTATCACACTGG - Intergenic
1067222315 10:44353059-44353081 ACTGCTGTGGGGCAGCTCAACGG + Intergenic
1069963580 10:72094927-72094949 ACTGCTGTGAGCCACCACACTGG - Intergenic
1077138714 11:1014125-1014147 AGCTCTGTGGGGCTCCACAAGGG - Intronic
1077321450 11:1944363-1944385 ACTTCTGTGTGACACCATAGTGG + Intergenic
1078087292 11:8241897-8241919 ACTGCTGTGGGGCACAACACTGG - Intronic
1078423506 11:11231235-11231257 GCTTCTGTGGTAGACCACACTGG - Intergenic
1079283865 11:19111666-19111688 AGTGCTGTGGGGCACCTAACAGG + Intergenic
1082193445 11:49274021-49274043 CCTTCTCTGGGGCACCTCCCTGG - Intergenic
1085467939 11:76736918-76736940 ACCAGTGTGGGGCACCCCACAGG + Intergenic
1086672694 11:89567158-89567180 CCTTCTCTGGGGCACCTCCCCGG + Intergenic
1087049001 11:93867684-93867706 CCTTCTGTGGAGGACCCCACTGG - Intergenic
1088168622 11:106968655-106968677 TCTTCTGTGGGGACCTACACTGG + Intronic
1090090068 11:123688341-123688363 AGTTCTGCTGGGCATCACACAGG + Intergenic
1092681240 12:10983492-10983514 ACTTCAATGGAACACCACACTGG + Intronic
1096494113 12:52029410-52029432 ACAGGTGTGGGCCACCACACCGG - Intronic
1096577130 12:52559824-52559846 ACAGGTGTGGGCCACCACACCGG + Intergenic
1100743359 12:97619388-97619410 ACTTCTGTGCGTCCTCACACAGG - Intergenic
1104065294 12:125300449-125300471 ACTTCTCTAGGGCCACACACAGG - Intronic
1107418296 13:40221623-40221645 ACCACTGTGGGGCCCCAAACTGG + Intergenic
1108282041 13:48870493-48870515 CCATCTGTGTGGCACCCCACTGG - Intergenic
1109746097 13:66624541-66624563 ACTTCTCTTGGGCACCCTACAGG + Intronic
1111698806 13:91660359-91660381 ACTTATGTGGGCCACTCCACAGG - Intronic
1112429758 13:99341198-99341220 ACTTCTGTGAGCCAGCCCACAGG + Intronic
1112838408 13:103545816-103545838 ACCTCTGTGGGCCATCACAGGGG + Intergenic
1113231139 13:108215330-108215352 AAGTCTGTGGGGCAACAGACCGG - Intronic
1118189746 14:63569699-63569721 ACAGGTGTGGGCCACCACACTGG + Intergenic
1118981079 14:70717643-70717665 AGTTCTGTGTGGGACCAGACAGG - Intergenic
1120685468 14:87531961-87531983 TCTCCTGTGTGGAACCACACAGG + Intergenic
1121415181 14:93774416-93774438 ACTTCTAGGGGGCACTTCACAGG + Intronic
1126912380 15:53430202-53430224 CCATCTGTGCGGGACCACACTGG - Intergenic
1129899479 15:79135391-79135413 AATTCTGTGGTGCATCACCCAGG + Intergenic
1130965445 15:88694349-88694371 TCTTAGGTGGGGCACCAGACTGG - Intergenic
1132138628 15:99369503-99369525 AATTCTGCGGGGCACCAGGCTGG + Intronic
1132151784 15:99467321-99467343 GCTTCTCTGGGGCTCCCCACAGG - Intergenic
1132215711 15:100060275-100060297 ACTTCTGTGGGGCACCACACGGG + Intronic
1132674192 16:1114905-1114927 GCCTCTGTGGGGCTCCACAGGGG - Intergenic
1135479707 16:22813105-22813127 ACTTCCCTGAGGGACCACACTGG - Intergenic
1136772657 16:32855422-32855444 CCTTCTGTGGGGCAACAGAGGGG - Intergenic
1136897957 16:34006097-34006119 CCTTCTGTGGGGCAACAGAGGGG + Intergenic
1137277505 16:46945883-46945905 ACAGGTGTGGGCCACCACACTGG - Intergenic
1137351073 16:47714389-47714411 ACCCCTGAGGGGCACCACAGAGG + Intergenic
1137654538 16:50148887-50148909 ACTTGTGTGCGCCACCACCCCGG + Intergenic
1138474761 16:57264156-57264178 GCTTCTGTAGGGATCCACACAGG - Intronic
1139588626 16:67920401-67920423 ACAGGTGTGGGCCACCACACCGG + Intronic
1140734019 16:77881850-77881872 ACTGCTGTGGGTAACCACACTGG + Intronic
1203075082 16_KI270728v1_random:1117532-1117554 CCTTCTGTGGGGCAACAGAGGGG - Intergenic
1143059795 17:4190162-4190184 ACTGCTGTGAGCCACCACACTGG - Intronic
1143207283 17:5152852-5152874 ACAGGTGTGTGGCACCACACCGG - Intronic
1145094612 17:20015042-20015064 ACTGCGCTTGGGCACCACACTGG + Intronic
1145274508 17:21421758-21421780 ACTGCTGTTGGGGAGCACACAGG - Intergenic
1145312364 17:21707657-21707679 ACTACTGTTGGGGAGCACACAGG - Intergenic
1158245606 18:55429287-55429309 ACTTCTGTGGGGACCCACAAAGG - Intronic
1161348283 19:3778592-3778614 ACTTCTGTGGGGCCCGAGACGGG + Exonic
1163318380 19:16556942-16556964 GCTTCTGCGGGGAACCTCACTGG + Intronic
1164459201 19:28433229-28433251 CCATCTGTGGGGGACCCCACTGG - Intergenic
1165114279 19:33519733-33519755 GATTCTCTGGGCCACCACACAGG - Intronic
1165282203 19:34807138-34807160 TCTTCTGTGACTCACCACACTGG + Intergenic
1168163756 19:54532769-54532791 ACTTCTATTGGGCAGGACACAGG - Exonic
1168237774 19:55074410-55074432 CCTTCTGTGTGTCAGCACACTGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
929800582 2:45097257-45097279 ACAGGTGTGTGGCACCACACAGG - Intergenic
931412587 2:62047594-62047616 ACAGCTGTGTGCCACCACACTGG + Intronic
935828949 2:106979131-106979153 ACTACTGTAGGGCACTAGACAGG + Intergenic
935993058 2:108738904-108738926 ACTTGTGTGAGCCACCGCACAGG + Intronic
936870819 2:117132663-117132685 CCTTCTGTGGAGGACCCCACTGG + Intergenic
937102032 2:119279095-119279117 ACTTCTCTGGGGAACAACATTGG - Intergenic
937380094 2:121368567-121368589 TCTGCTGTGGGGCACACCACTGG + Intronic
938408776 2:131047036-131047058 AATTCTGTGGCTCAGCACACAGG + Exonic
943360418 2:186912221-186912243 ACAGCTGTGAGCCACCACACCGG - Intergenic
945991483 2:216399276-216399298 ACCTCTGTGGGTCACAACAGAGG + Intergenic
948014757 2:234679019-234679041 ACTTCTGTGGGTCAGCAGACTGG - Intergenic
948563326 2:238868096-238868118 ACCTTTGTGGGGCACTGCACTGG - Intronic
948597741 2:239091347-239091369 GCTGCTGTGGGGTAACACACCGG + Intronic
1169369579 20:5018423-5018445 ACTTCTGTGGGTCACCACCCTGG - Intergenic
1173535315 20:43806315-43806337 ACATGGGTGGGCCACCACACCGG + Intergenic
1175059882 20:56232298-56232320 ACTTCTGTTGGACCCCACACAGG + Intergenic
1177420534 21:20851452-20851474 ACTAATGAGGGCCACCACACAGG - Intergenic
1181688981 22:24547861-24547883 ACCTCTGTGTGGCCCCACATGGG + Intronic
1183193183 22:36335030-36335052 ACTTCTATAGGGCACCAAAAAGG - Intronic
1183792175 22:40080996-40081018 ACATGTGTGTGTCACCACACTGG + Intronic
1184407234 22:44307084-44307106 AGGTCTGTGGGACACCACTCCGG + Intronic
1185321502 22:50202028-50202050 ATTTCTGTGGGGGGGCACACAGG + Intronic
949815656 3:8055123-8055145 ACTTCTGTGGGGCAGCTCTGAGG - Intergenic
950057936 3:10042839-10042861 AATTCTGTGAGGTACTACACAGG - Intronic
951894377 3:27596962-27596984 CCTTCTGTGGGGACACACACAGG + Intergenic
954159265 3:48708793-48708815 ACGTGTGTGAGCCACCACACGGG - Intronic
954965070 3:54603216-54603238 TCTTCTGTGGAGCCTCACACTGG - Intronic
962216982 3:133531211-133531233 AGGACTGTGGGGCTCCACACTGG - Intergenic
966869001 3:184277906-184277928 TTTTCTGTGGGGCAGAACACAGG - Exonic
968229799 3:196998727-196998749 ACAGGTGTGGGCCACCACACTGG + Intronic
968579408 4:1383005-1383027 CCTTGTGTGGGGAACCCCACAGG + Intronic
970376796 4:15466854-15466876 ACTTCTGCCTGGCACCCCACGGG + Intergenic
971481016 4:27115102-27115124 AGATCTGTGGGGGAACACACAGG + Intergenic
972562581 4:40241746-40241768 ACATGTGTGTGCCACCACACCGG - Intronic
975484401 4:74918367-74918389 ACAGATGTGGGGTACCACACTGG - Intergenic
977483415 4:97609327-97609349 GGTTCTGTGAGACACCACACTGG - Intronic
978577311 4:110199730-110199752 ACTTCTGTGAGCCACCACCGCGG - Intergenic
978580666 4:110228503-110228525 ACTGCTCTTGGACACCACACTGG - Intergenic
982350254 4:154407661-154407683 GGTTGTGTGGGGCACCTCACTGG - Intronic
986150124 5:5120616-5120638 ATGTCTGTGGGGCCCCACATGGG - Intergenic
988697581 5:33638723-33638745 AGTACTGTGAGGCACCACAGAGG - Intronic
994205156 5:97026820-97026842 ACTTCTGTGAGCCAAAACACTGG - Intronic
997850994 5:137332317-137332339 ATTACTGTGAGGCACCAAACAGG - Intronic
997902679 5:137781967-137781989 ACTGGTGTGAGCCACCACACCGG - Intergenic
999237172 5:150105801-150105823 ACATGTGTGAGCCACCACACTGG + Intronic
1005517826 6:26571339-26571361 ACAGCTGTGCGCCACCACACCGG - Intergenic
1008825881 6:55693016-55693038 ACATGTGTGTGCCACCACACTGG - Intergenic
1017991010 6:159489831-159489853 ACCTCTGTGGGTCCCCACTCTGG + Intergenic
1019945558 7:4326035-4326057 TCGTCTGTGTGGCATCACACAGG + Intergenic
1024084641 7:45883208-45883230 CCTTCTGTCCAGCACCACACAGG - Intergenic
1029361567 7:100091924-100091946 TCCTCTGTTAGGCACCACACTGG + Exonic
1032265147 7:130365367-130365389 ACTTCTGTGGGTCTCACCACAGG + Intronic
1035650656 8:1261509-1261531 ACTTATGCGGGGCTCCCCACCGG - Intergenic
1037166946 8:15841788-15841810 ACAGCTGTGAGCCACCACACCGG + Intergenic
1039415437 8:37389978-37390000 ACATCTCTTGGGTACCACACAGG + Intergenic
1041312323 8:56529598-56529620 ACATCAGTGGGGGAACACACAGG + Intergenic
1044258594 8:90093575-90093597 CCATCTGTGCGGGACCACACTGG - Intronic
1044755844 8:95460415-95460437 ACTTGTTTGGGGCATCACATAGG + Intergenic
1047408056 8:124601654-124601676 ACTTCTGTGATGCAACACCCGGG - Intronic
1048510107 8:135054574-135054596 ACGGGTGTGGGGCACCATACTGG - Intergenic
1048717296 8:137283786-137283808 CCTTCTGTGGAGGACCCCACTGG + Intergenic
1048843101 8:138582058-138582080 CCTTCTGTGGGACTCCACCCTGG - Intergenic
1049181954 8:141227565-141227587 ACTTCTGAAGGGCCCCAGACAGG + Intronic
1049232942 8:141493612-141493634 ACTTCTCTGGGGGAGCACAGGGG + Intergenic
1049329539 8:142042937-142042959 AGTCCTGTGGGGAACCTCACAGG + Intergenic
1049829122 8:144688468-144688490 ACAGCTGTGAGCCACCACACAGG - Intergenic
1050414573 9:5402518-5402540 ACTCCTGCTGGGAACCACACTGG + Intronic
1050580540 9:7050674-7050696 CCTTCTGAGGGGCACTGCACTGG - Intronic
1052620570 9:30903661-30903683 ACTTCTCTGGGGCTCCAGCCTGG - Intergenic
1057359804 9:94362705-94362727 ACATGTGTGCGCCACCACACTGG - Intergenic
1060496731 9:124124901-124124923 CCTTCTGTGGGGCAGCTCATGGG - Intergenic
1060737857 9:126077998-126078020 CCATCTGTGGGGGACCCCACTGG - Intergenic
1061080809 9:128368937-128368959 ACAGGTGTGAGGCACCACACTGG - Intergenic
1186863306 X:13694583-13694605 ACATTTGTAGGGCACCCCACTGG - Intronic
1191879554 X:65831349-65831371 ACAGCTGGGGGGCACCACCCTGG + Intergenic
1195487387 X:105424911-105424933 AATTCTGTGGGACATCACCCGGG + Intronic