ID: 1132217584

View in Genome Browser
Species Human (GRCh38)
Location 15:100077610-100077632
Sequence GAGCATGCTCAACCTGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 1, 2: 6, 3: 83, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132217579_1132217584 17 Left 1132217579 15:100077570-100077592 CCTTCCTGATAAAAATACTCAAC 0: 1
1: 6
2: 77
3: 467
4: 1950
Right 1132217584 15:100077610-100077632 GAGCATGCTCAACCTGATAAAGG 0: 1
1: 1
2: 6
3: 83
4: 329
1132217580_1132217584 13 Left 1132217580 15:100077574-100077596 CCTGATAAAAATACTCAACAAAC 0: 1
1: 5
2: 29
3: 120
4: 471
Right 1132217584 15:100077610-100077632 GAGCATGCTCAACCTGATAAAGG 0: 1
1: 1
2: 6
3: 83
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132217584 Original CRISPR GAGCATGCTCAACCTGATAA AGG Intronic
901256410 1:7831592-7831614 GAACTTCCTCAATCTGATAAGGG - Intronic
903025148 1:20423796-20423818 GAACCTCCTCAACCTAATAATGG + Intergenic
904854194 1:33484338-33484360 GAACTTCCTCAACTTGATAAAGG - Intronic
905339756 1:37270479-37270501 GAGGATGCTGAACCTGTGAAGGG + Intergenic
907631151 1:56083518-56083540 GTGAGTGCCCAACCTGATAACGG + Intergenic
907944208 1:59118686-59118708 GAACTTCCTCAACCTAATAAAGG - Intergenic
908012814 1:59798678-59798700 CAGCATTCTCAACATGATAAAGG - Intergenic
909396152 1:75173066-75173088 GAGTATGCTCAACCTGTTCTGGG + Intergenic
910151986 1:84159738-84159760 GAACTTCCTCAAACTGATAAAGG - Intronic
910776157 1:90877390-90877412 GATCTTCCTCAACTTGATAAAGG - Intergenic
911668405 1:100581577-100581599 GCACATGCTCAACCTGAGAATGG - Intergenic
912271849 1:108219173-108219195 GAACTTCCTCAACCTGATAGAGG - Intergenic
912740849 1:112195764-112195786 GAACTTTCTCAACCTGGTAAAGG + Intergenic
913577013 1:120185842-120185864 GAACTTCTTCAACCTGATAAAGG + Intergenic
914218627 1:145656836-145656858 GAACTTCCTCAACCTGATAAAGG - Intronic
914471184 1:147979531-147979553 GAACTTCCTCAACCTGATAAAGG - Intronic
914558923 1:148797278-148797300 GAACTTCTTCAACCTGATAAAGG + Intergenic
914613910 1:149332952-149332974 GAACTTCTTCAACCTGATAAAGG - Intergenic
914938926 1:152004780-152004802 GAGCATGCTCAGGCTGATGTGGG - Intergenic
914976667 1:152370855-152370877 GAACTTTCTCAACCTGATAATGG + Intergenic
916067863 1:161150986-161151008 GAACTTCCTCAACCTGACAAGGG + Intergenic
917149187 1:171926889-171926911 GAACTTCCTCAACCTGGTAAAGG + Intronic
917769013 1:178256339-178256361 GAACTTTCTCAGCCTGATAAAGG + Intronic
918643081 1:186867845-186867867 GAGCTTTATCAACTTGATAAAGG - Intronic
922112190 1:222571225-222571247 GAACTTCCTCAATCTGATAAAGG + Intronic
922922882 1:229322166-229322188 CAGCATTATCAACCTGAAAAAGG + Exonic
923186808 1:231581101-231581123 GAACTTCCTCAACCTGATAAAGG - Intronic
923379822 1:233405730-233405752 GAACTTTCTCAACCTGATAGTGG + Intergenic
923780400 1:237017330-237017352 AAGTTTCCTCAACCTGATAAAGG - Intergenic
924333199 1:242961288-242961310 GAACTTCCTCAACCAGATAAAGG - Intergenic
924389716 1:243540429-243540451 GAACTTCCTCAATCTGATAAAGG + Intronic
1062847182 10:717048-717070 GAACTTCCTCAATCTGATAAAGG - Intergenic
1062887665 10:1030721-1030743 GAACTTCTTCAACCTGATAAAGG - Intergenic
1063357860 10:5417820-5417842 GAACTTCCTCAACCTGATAAAGG - Intronic
1064465812 10:15580768-15580790 GAACATCCTCAACTTGATAAAGG + Intronic
1064779179 10:18814741-18814763 AAGCTTCCTCAACTTGATAACGG - Intergenic
1064859246 10:19808937-19808959 AATCTTGCTCAACCTGATAAAGG + Intergenic
1065786213 10:29218083-29218105 GAGCTGGCTCAACCAGAAAATGG - Intergenic
1067253053 10:44605893-44605915 AAACTTTCTCAACCTGATAAAGG - Intergenic
1067383813 10:45800139-45800161 GAAGCTCCTCAACCTGATAATGG + Intergenic
1067688454 10:48482599-48482621 GAACTTTCTCAACCTGATTAAGG - Intronic
1069565149 10:69458981-69459003 GCTCACGGTCAACCTGATAAGGG + Intronic
1071581439 10:86774907-86774929 AACCTTCCTCAACCTGATAAAGG + Intronic
1071921159 10:90352076-90352098 TAGCATGCTCAAGCTGGGAAAGG + Intergenic
1072111134 10:92321262-92321284 GGACATCCTCAACCTGATAAAGG - Intronic
1072194114 10:93100775-93100797 GAACTTCCTCAACTTGATAAAGG - Intergenic
1073521527 10:104135222-104135244 GAACTTCCTCAACATGATAATGG + Intronic
1073720595 10:106166591-106166613 GAACTTGCTCAACCTGATAAAGG + Intergenic
1073820728 10:107260896-107260918 GAACTTCCTCAATCTGATAAAGG + Intergenic
1074172728 10:110959540-110959562 GTCCATGCTAAACATGATAAAGG - Intronic
1074698204 10:116069875-116069897 CAGCATGCTCACTCTGATTATGG + Intronic
1074802122 10:117010914-117010936 GAACATCCTCACCATGATAAAGG + Intronic
1075272790 10:121067846-121067868 GAACTTCCTCAACCTGAGAAAGG - Intergenic
1075423163 10:122320345-122320367 GAACCTCCTCAACATGATAAAGG - Intronic
1075869073 10:125755149-125755171 AAACATCCTCAACTTGATAAAGG - Intronic
1076763956 10:132621112-132621134 GAGCATTCTCAGCCTGTAAAGGG + Intronic
1076805248 10:132853198-132853220 AAACTTCCTCAACCTGATAAAGG - Intronic
1077447755 11:2607225-2607247 GAACATCCTCAACCTGATAAAGG - Intronic
1078935595 11:15946829-15946851 GAACTTCCTTAACCTGATAAAGG - Intergenic
1079364780 11:19799696-19799718 GAGCATGTGCAAACTGTTAAGGG + Intronic
1081391418 11:42533850-42533872 GAACTTCCTCAACCTGATAAAGG + Intergenic
1083297120 11:61720807-61720829 GCGCATGCTCAGCCAGATGATGG - Exonic
1084368846 11:68724380-68724402 AAGCATCCTTAACCTGAGAAGGG + Intronic
1085158294 11:74316825-74316847 GAACCTCCTCAACCTGATTAGGG - Intergenic
1086008669 11:82071431-82071453 CAACATCCTCAACCTCATAAAGG + Intergenic
1086147355 11:83567173-83567195 CAGCATTCTCAACCTCAGAAGGG + Intronic
1086518104 11:87637702-87637724 AAGCATGGACAACCTTATAAAGG - Intergenic
1087054113 11:93916693-93916715 GAACTTCCTCAACTTGATAAAGG - Intergenic
1087223327 11:95569894-95569916 CAGCATACTCCACCTGATACAGG - Intergenic
1089123238 11:116156283-116156305 CAGCTTCCTCAACCTGATAAAGG + Intergenic
1089369364 11:117943971-117943993 GAACTTCCTCAACTTGATAAGGG - Intergenic
1090998577 11:131889148-131889170 GAACATTCTTAACATGATAAGGG + Intronic
1092299794 12:7236057-7236079 GAACTTTCTCAACCTGTTAAAGG + Intergenic
1094574768 12:31675090-31675112 TAACTTCCTCAACCTGATAAAGG + Intronic
1095223775 12:39653962-39653984 GAACTTTCACAACCTGATAAAGG - Intronic
1095223780 12:39654111-39654133 GAACTTTCACAACCTGATAAAGG - Intronic
1096662576 12:53136594-53136616 GATTTTTCTCAACCTGATAAAGG - Intergenic
1097374857 12:58829796-58829818 GAGCTTATTCAATCTGATAAAGG + Intergenic
1098164991 12:67686668-67686690 GAACTTCCTCAACCTGATAAAGG - Intergenic
1098268787 12:68750298-68750320 GAGCATCCTTAACCTTATATTGG - Intronic
1100928193 12:99574767-99574789 AAACTTTCTCAACCTGATAAAGG + Intronic
1101890148 12:108706276-108706298 GAATTTCCTCAACCTGATAATGG + Intronic
1104655332 12:130570227-130570249 GAGCCTGCGCAACATGGTAAAGG + Intronic
1105435785 13:20377238-20377260 GAACTTTCACAACCTGATAAAGG + Intergenic
1108564878 13:51686055-51686077 GAGAAAGCTCTACTTGATAAAGG - Intronic
1108889544 13:55236959-55236981 TAACTTCCTCAACCTGATAAAGG + Intergenic
1109173321 13:59123558-59123580 GAGCTTCCTCAATCTGATAAAGG + Intergenic
1109728758 13:66381936-66381958 GGGCAAGCTCAATGTGATAAGGG + Intronic
1110156954 13:72328396-72328418 GAACATTCTCAACCTGAAAAAGG + Intergenic
1110811461 13:79815430-79815452 GAGCTTCCTCAATCTGATAAAGG - Intergenic
1112070465 13:95844938-95844960 GAACTTCCTCATCCTGATAAAGG - Intronic
1112251780 13:97788017-97788039 GAGATTCCTCAACATGATAAAGG - Intergenic
1112866323 13:103904817-103904839 GAACTTCATCAACCTGATAAAGG - Intergenic
1115366373 14:32562097-32562119 GAGCCTCATCAACCTGAGAATGG - Intronic
1116125785 14:40783208-40783230 GAGCTTTCCCAACTTGATAAAGG - Intergenic
1117727472 14:58688578-58688600 GAACTTCCTCAACCAGATAAAGG - Intergenic
1119493327 14:75056859-75056881 AAACTTCCTCAACCTGATAAAGG + Intronic
1119943196 14:78663436-78663458 GATATTGCTCAACCTGCTAACGG + Intronic
1120176532 14:81299353-81299375 GAACTTCCTCAACCTGATAAAGG + Intronic
1120956184 14:90084766-90084788 GATCTTTCTCAACCTGGTAAAGG - Intronic
1121670446 14:95706650-95706672 GAACTTCCTCAATCTGATAAAGG + Intergenic
1121785038 14:96651775-96651797 GAAAATCCTCAACTTGATAAAGG - Intergenic
1122276944 14:100596026-100596048 AAACGTTCTCAACCTGATAAAGG + Intergenic
1122932556 14:104941226-104941248 GAGCATTCTGAAGATGATAAAGG + Exonic
1123178339 14:106443175-106443197 GAGCATGCTCTATCTGCAAATGG - Intergenic
1124037344 15:26067185-26067207 GAACTTCCTCAACCTGATAAAGG - Intergenic
1124060183 15:26284805-26284827 AAGCTTTCTCAACCTGATAAAGG - Intergenic
1124873798 15:33571233-33571255 GAACTTCCTCGACCTGATAAAGG - Intronic
1125116361 15:36096696-36096718 GATCTTTCTCAAACTGATAAAGG + Intergenic
1125167058 15:36719272-36719294 GAGTTTCTTCAACCTGATAAAGG - Intronic
1125830519 15:42713542-42713564 GAATTTCCTCAACCTGATAAAGG - Intronic
1125868045 15:43072674-43072696 GAACTTCCTCAACCTGATAAAGG - Intronic
1127411943 15:58717957-58717979 GAACTTGCTCAGCTTGATAAAGG - Intronic
1129047276 15:72746803-72746825 GAACATCTTCAACCTGATGAAGG + Intergenic
1129569191 15:76660583-76660605 AAGCTTCCTCAATCTGATAAAGG + Intronic
1129620553 15:77140586-77140608 GAACATCCTCAACCTGACAAAGG + Intronic
1129639381 15:77359049-77359071 GAACTTCCTAAACCTGATAATGG + Intronic
1131293399 15:91126843-91126865 GAACTTCCTTAACCTGATAAAGG + Intronic
1132217584 15:100077610-100077632 GAGCATGCTCAACCTGATAAAGG + Intronic
1132253676 15:100354870-100354892 GACCTTCCTCAACCTGATAAAGG + Intergenic
1134411825 16:14009660-14009682 GAACTTCCTCAACCAGATAAAGG - Intergenic
1134421878 16:14100250-14100272 GAACATCCTCAACCTGATAAAGG - Intronic
1134863295 16:17580560-17580582 GAACTTCCTCAACATGATAAAGG + Intergenic
1135697113 16:24598212-24598234 GAACTTCATCAACCTGATAAAGG - Intergenic
1135996112 16:27250389-27250411 GAACTTCCTTAACCTGATAAAGG - Intronic
1137248464 16:46725428-46725450 GAACTTCCTCAACCTGATAACGG - Intronic
1138020315 16:53473789-53473811 GAACTTCCTCAACCTGATAAAGG - Intronic
1139370418 16:66465045-66465067 GAACTTCTTCAACCTGATAAAGG - Intronic
1140324622 16:73989768-73989790 GAGTTTATTCAACCTGATAAAGG + Intergenic
1140492499 16:75350029-75350051 GAACTTCCTCAATCTGATAAAGG - Intronic
1143085772 17:4414931-4414953 GAACATCCTCCACCTGATACAGG - Intergenic
1143246807 17:5493278-5493300 GAATTTCCTCAACCTGATAAAGG + Intergenic
1144336388 17:14273634-14273656 GAGCTTCCTCAACATGATAAAGG - Intergenic
1144361120 17:14494215-14494237 AAGCGTCCTCAACCAGATAAAGG - Intergenic
1145100288 17:20070263-20070285 GAACTTCCTCAACTTGATAAAGG - Intronic
1145387371 17:22425442-22425464 GAACTTCCTCAAGCTGATAAAGG - Intergenic
1145786369 17:27596446-27596468 AAGCATGCTCCCCCTGCTAATGG - Intronic
1149083923 17:52691789-52691811 GGGTATGCTCAACCTGCTTAAGG - Intergenic
1149128725 17:53268867-53268889 GAACTTTCTCAACCTGATAAAGG - Intergenic
1149648631 17:58260536-58260558 GAACTTCCTCAACCTCATAAAGG - Intronic
1149745844 17:59097106-59097128 GAACTTCCTCAACTTGATAAAGG + Intronic
1150001185 17:61441443-61441465 GAGCATTCTGAACCTGAAAAGGG + Intergenic
1150461077 17:65353131-65353153 GAACTTTCTTAACCTGATAAAGG + Intergenic
1150735512 17:67733635-67733657 GAGCTTCCTTAACATGATAAAGG - Intronic
1150826911 17:68484685-68484707 GAGCTTTTTCAACCTGTTAAAGG - Intergenic
1152397452 17:80042804-80042826 GAACTTCCTTAACCTGATAAAGG - Intronic
1152513962 17:80811234-80811256 GCACTTCCTCAACCTGATAATGG - Intronic
1152648667 17:81481989-81482011 GAGAAGGCTCACCCTGAAAACGG - Intergenic
1154392391 18:13950571-13950593 AAGCATTCTTAACCTGAAAAAGG - Intergenic
1155553132 18:26987882-26987904 GACCATGCTCAACCTGATACTGG + Intronic
1156167613 18:34441831-34441853 GAACTTACTCAACCTGATAAAGG - Intergenic
1156823400 18:41400330-41400352 TAACTTCCTCAACCTGATAAAGG + Intergenic
1158270488 18:55708627-55708649 GAGCTTCCTCAGCCTGAAAAAGG - Intergenic
1158928515 18:62296669-62296691 AAACTTCCTCAACCTGATAAAGG - Intronic
1159177536 18:64857366-64857388 GAACTTGCTCATCCCGATAAAGG - Intergenic
1160398864 18:78594160-78594182 GAACTTCCTCAACCTGATAAAGG + Intergenic
1160886752 19:1353566-1353588 GAACATTCTCAACTTGATAAAGG + Intergenic
1161223309 19:3129474-3129496 GAACTTCCTCAACCTGATAAAGG + Intergenic
1161743099 19:6036727-6036749 GAACTTCCTCAACCTGAAAAAGG + Intronic
1166412879 19:42568374-42568396 GAGGATGCTCATCCTCAGAAAGG - Intergenic
1168296757 19:55380711-55380733 CACCATGCCCAACCTCATAAAGG + Intronic
925511539 2:4631561-4631583 GAACATCCTGAACCTAATAAAGG + Intergenic
926708784 2:15858302-15858324 GAACTTCCTCAACCTGACAAAGG - Intergenic
926882876 2:17567709-17567731 GAATATCCTTAACCTGATAAAGG - Intronic
927406241 2:22771920-22771942 GAACATCCCCAACCTGATAGTGG + Intergenic
927535701 2:23856413-23856435 GATAATGCTCAACCTGCTACAGG - Intronic
927669527 2:25057491-25057513 CACCGTGCTCAGCCTGATAATGG - Intronic
927740554 2:25565567-25565589 GAACTTTCTCAACCTGAAAAAGG - Intronic
927746744 2:25629749-25629771 AAACTTCCTCAACCTGATAAAGG + Intronic
929710626 2:44262990-44263012 GAAACTGCTCAACTTGATAAAGG + Intergenic
929812029 2:45198297-45198319 GAACTTCTTCAACCTGATAAAGG + Intergenic
931315894 2:61131046-61131068 GAACTTCCTCAACTTGATAAAGG + Intronic
931368990 2:61644465-61644487 GAGCCTTCTCAACCTGATAAAGG + Intergenic
931403650 2:61954961-61954983 CACCATGCCCAGCCTGATAAAGG + Intronic
931541706 2:63336498-63336520 GAACTTCCTCAACATGATAAAGG - Intronic
932342101 2:70970255-70970277 GAACTTCCTCAACTTGATAAAGG - Intronic
932661675 2:73659495-73659517 GAACTTCCTCAACCTGTTAAAGG - Intergenic
933640691 2:84756142-84756164 GAACTTCCTCAACCTGATAAGGG - Intronic
933681026 2:85100976-85100998 GGGAATTCTCAACCTGATAAGGG + Intergenic
933883263 2:86693068-86693090 GAACATCCTGAACTTGATAAAGG + Intronic
936400207 2:112159081-112159103 GATCATGCTTATCATGATAAAGG - Intronic
937838663 2:126501489-126501511 GAACTTCCTCATCCTGATAAAGG + Intergenic
937899449 2:127006644-127006666 GAATGTCCTCAACCTGATAAAGG + Intergenic
938113143 2:128582972-128582994 GGGCTTCTTCAACCTGATAAAGG - Intergenic
938151320 2:128886991-128887013 AAACTTCCTCAACCTGATAAAGG - Intergenic
939230330 2:139416316-139416338 GAACTTACTCAACCTGTTAAAGG - Intergenic
940070525 2:149682202-149682224 AAGCACTCTCAATCTGATAAGGG - Intergenic
940079922 2:149788941-149788963 GAACTTCCTCAACCTGATGAAGG - Intergenic
940132566 2:150399912-150399934 GAACTTGCTCAACCTAATAAAGG - Intergenic
941293296 2:163702976-163702998 GACCTTGCTCAACCTGTTCAGGG - Intronic
941742061 2:169045476-169045498 GAGCCTCCTCAACATGATAAAGG + Intergenic
941985394 2:171505639-171505661 GAACTTCCTCAACATGATAAAGG - Intergenic
942028223 2:171931973-171931995 AAACTTCCTCAACCTGATAAAGG - Intronic
944722821 2:202440854-202440876 GATCATTCTCAATGTGATAAAGG - Intronic
945366152 2:208956820-208956842 GGGCTTGCTCAACCTGCAAATGG + Intergenic
945456141 2:210054592-210054614 GAACTTCCTCAACATGATAAAGG + Intronic
945485391 2:210389383-210389405 GAGAATTCTCAACTTTATAAAGG - Intergenic
946383564 2:219366762-219366784 GAGCTTGCTCAACCTGATAAAGG - Intergenic
947867746 2:233412741-233412763 GAACATCCTCAAACTGATAAAGG - Intronic
948190984 2:236058568-236058590 AAACTTGCTGAACCTGATAAAGG + Intronic
948451306 2:238075060-238075082 GAACTTCCTCATCCTGATAAAGG - Intronic
948561254 2:238854771-238854793 GAGCATGAACAACCTCCTAAAGG + Intronic
1169393438 20:5209039-5209061 GAACTTCCTCAACCTCATAAAGG + Intergenic
1169406670 20:5326942-5326964 TAGCATGCTCTGCCTGAGAAGGG - Intergenic
1169456536 20:5757440-5757462 AAACTTCCTCAACCTGATAAAGG - Intronic
1169875456 20:10292450-10292472 AAGCATCCTCAACCAGATAAGGG - Intronic
1170054390 20:12183782-12183804 GAACTTCCTCAACCTGATAGAGG - Intergenic
1170410837 20:16089535-16089557 GAGCTTTCTTAACCTGATAAAGG + Intergenic
1172524899 20:35594533-35594555 GAACTTCCTCAACCTGATAAAGG + Intergenic
1173196801 20:40920982-40921004 GAACTTTCTCAACCTGATAAAGG + Intergenic
1175351161 20:58319776-58319798 GAACATCTTCAACCTGATAATGG - Intronic
1175376510 20:58529393-58529415 GAACAATCTCAACCTGATAAAGG - Intergenic
1177788478 21:25696442-25696464 GAGCATGAACAACATGAAAAAGG - Intronic
1178974778 21:37211863-37211885 GAACTTCCTCAACCTGCTAAAGG - Intergenic
1178986435 21:37308047-37308069 GAACTTCCTCAACCTGATAAGGG - Intergenic
1179378476 21:40875593-40875615 GAACTTTCTCAATCTGATAAAGG + Intergenic
1179903982 21:44411744-44411766 GAACTTCTTCAACCTGATAAAGG - Intronic
1180029324 21:45193382-45193404 AAACCTTCTCAACCTGATAAAGG + Intronic
1180110910 21:45649813-45649835 GATCATCCTTAACCTAATAAAGG - Intronic
1181597484 22:23925875-23925897 GAGCATTCTAAACTTCATAAGGG - Intergenic
1183905092 22:41034535-41034557 GAACATGCTCAGCCTGAACACGG - Intergenic
949716944 3:6944326-6944348 GAACTTCCTCAACCTCATAAAGG - Intronic
949791307 3:7795239-7795261 AAACTTCCTCAACCTGATAAAGG - Intergenic
950877854 3:16293805-16293827 GAACTTTCTCAACCTGATAAAGG - Intronic
952400367 3:32957736-32957758 TAGCATGCTCAAACTAACAAAGG - Intergenic
952421862 3:33139435-33139457 GAACTTCCTCAACCTAATAAAGG - Intronic
952775795 3:37044810-37044832 GAACTTCCTCAACCTCATAATGG - Intronic
953268001 3:41411830-41411852 GACATTCCTCAACCTGATAAAGG + Intronic
953995738 3:47518308-47518330 GAACATTTTCAACCTGATAAAGG - Intergenic
954120764 3:48498199-48498221 GAACTTCCTCAACCTGATAAAGG + Intronic
954598540 3:51849752-51849774 GAACTTCCTCAACCTGATAAGGG + Intergenic
954889276 3:53909603-53909625 GAACTTCCTCAACTTGATAAAGG + Intergenic
955305351 3:57825385-57825407 GAACTTCCTCAACATGATAAAGG - Intronic
955695684 3:61633849-61633871 GAACTTCCTCAACCTGAAAAAGG - Intronic
955805439 3:62729252-62729274 GAGCATGATCACCCTCATAATGG + Intronic
959243715 3:103834725-103834747 GAGCATACCTAACATGATAAAGG + Intergenic
960885980 3:122395109-122395131 GAACTTCCTCAACCTGATAAAGG + Intronic
961233853 3:125346309-125346331 GAACTTCCTCAACCTGATAAAGG + Intronic
961482045 3:127188127-127188149 GAACTTTCTCAACTTGATAAAGG - Intergenic
961515964 3:127436186-127436208 AAACTTCCTCAACCTGATAAAGG + Intergenic
961670992 3:128530437-128530459 GAACTTCCTCAACCTGATAAAGG - Intergenic
961956782 3:130812516-130812538 GAACTTCCTCAACCTGATAAAGG + Intergenic
962815821 3:138998178-138998200 GAACTTCCTCAGCCTGATAAAGG - Intergenic
963035540 3:141022955-141022977 GAGATTTCTCAACCTGATTAGGG - Intergenic
963153049 3:142066996-142067018 AAACTTACTCAACCTGATAAAGG + Intronic
964513263 3:157476873-157476895 GAGCAGTCACAACCTGAGAAAGG + Intronic
964911072 3:161780813-161780835 GATCTTTCTTAACCTGATAATGG - Intergenic
966702049 3:182864401-182864423 GAACTTCCTCAGCCTGATAAAGG - Intronic
966760388 3:183412874-183412896 AAGTTTCCTCAACCTGATAAAGG - Intronic
967003478 3:185360119-185360141 GAGCTTACTCACCTTGATAATGG + Intronic
967960327 3:194916020-194916042 GATCTTCCTCAAACTGATAAAGG - Intergenic
968342001 3:197963920-197963942 GAGCTTTCTCAATCTGATAAAGG - Intronic
971307151 4:25493367-25493389 GAACTTTCTCAACCTGATAAAGG + Intergenic
971631032 4:28994138-28994160 GAAAGTGCTGAACCTGATAAGGG + Intergenic
971988725 4:33864185-33864207 GAACTTCCTCAGCCTGATAATGG + Intergenic
972006780 4:34119497-34119519 GAGCATGCTGAGGCTGATAAAGG - Intergenic
973636556 4:52866471-52866493 GAGCATGCTCATCCTGTGAGGGG - Exonic
973660692 4:53103419-53103441 CAGAATGCTCCACCTGGTAATGG + Intronic
974273179 4:59679367-59679389 GAACTTGCTGATCCTGATAAGGG + Intergenic
975338558 4:73209933-73209955 GAACATCCTCAACCAGATAAAGG + Intronic
975360310 4:73461642-73461664 GAACTTCCTAAACCTGATAAAGG + Intergenic
975778156 4:77811771-77811793 GAACTTCCTCAACCTGATAAAGG + Intronic
976319825 4:83701100-83701122 GAATATCCTCAACCTGAAAAGGG - Intergenic
976568082 4:86575526-86575548 TAACGTCCTCAACCTGATAAAGG - Intronic
977734244 4:100393497-100393519 GAACTTCCTCAATCTGATAAAGG - Intergenic
979319698 4:119308746-119308768 GAACTTCCTCAACTTGATAAAGG + Intergenic
979995252 4:127424832-127424854 GAACGTGCTAAGCCTGATAAAGG + Intergenic
982119049 4:152122331-152122353 GACCACTCTCAATCTGATAAAGG - Intergenic
983203875 4:164891913-164891935 GAACTTTCTCAATCTGATAAAGG - Intronic
983367938 4:166819213-166819235 GAGCTTCCTCAATCTGACAAAGG + Intronic
984738237 4:183132356-183132378 GAACTTCCTTAACCTGATAATGG - Intronic
985374656 4:189322340-189322362 GAGGCTGCTTCACCTGATAAGGG + Intergenic
986892633 5:12327880-12327902 GAACTTTTTCAACCTGATAAAGG + Intergenic
988901935 5:35742695-35742717 GAGCATGCTCCAGCAGAAAAAGG - Intronic
990643799 5:57820130-57820152 TAACTTTCTCAACCTGATAAAGG - Intergenic
990971702 5:61514520-61514542 GAACTTCCTTAACCTGATAAAGG - Intronic
991153874 5:63406792-63406814 GAACTTGCTCAATCAGATAAAGG + Intergenic
991206618 5:64057412-64057434 GAGCATTCTCAAATTAATAAAGG + Intergenic
991309554 5:65221475-65221497 GAACATCCTCAAACTGACAAAGG + Intronic
991402445 5:66266757-66266779 GAACTTCCTCAACCTAATAAAGG - Intergenic
993113924 5:83695764-83695786 GAACTTCCTCAATCTGATAAAGG + Intronic
993308692 5:86300827-86300849 GAACTTCCTCAACCTGATAGAGG + Intergenic
993634352 5:90326167-90326189 GAGGATGTTCAGCCAGATAATGG + Intergenic
993714603 5:91263231-91263253 GAGAATCCTCAATCTGATAAAGG + Intergenic
994036246 5:95204361-95204383 GAGCATCCTCAACATGGTAAAGG + Intronic
994892554 5:105656149-105656171 AATCATTTTCAACCTGATAAAGG + Intergenic
995735040 5:115291117-115291139 GAACTTTCTCAACCTGATAGAGG - Intronic
996428250 5:123339101-123339123 GAACTTCCTCAATCTGATAAAGG - Intergenic
996797152 5:127360626-127360648 GCGTTTCCTCAACCTGATAAAGG - Intronic
997719279 5:136065031-136065053 GAGAATTGTCAACCAGATAATGG + Intergenic
997958868 5:138303139-138303161 GAACTTCCTCAACCTGATGATGG + Intronic
998465995 5:142344310-142344332 GAGCATGCACCAACTGGTAAGGG + Intergenic
998572293 5:143272899-143272921 GAACCTCCTCAACCTAATAAAGG - Intergenic
998580334 5:143367261-143367283 GAACATTCTCAATCTGATAAAGG + Intronic
999534757 5:152504220-152504242 GATCAAGCACAGCCTGATAAAGG - Intergenic
1000132690 5:158314994-158315016 GAGAATTCTCAAACTGATTAAGG - Intergenic
1000617815 5:163448941-163448963 GAACTTGCTCAACATGACAAAGG + Exonic
1003701879 6:8475408-8475430 GAACTTTCTAAACCTGATAAAGG - Intergenic
1004968726 6:20884345-20884367 GAACATTCTCAACATGTTAAAGG + Intronic
1005211693 6:23472894-23472916 TAACATCCTCAACTTGATAAAGG + Intergenic
1005849316 6:29808059-29808081 GACCTTCCTCACCCTGATAAAGG + Intergenic
1006611586 6:35297491-35297513 AAGCAAGCTCATCCTGATATTGG - Intergenic
1007123654 6:39405363-39405385 GAACTTTCTCAACCTGATGAAGG - Intronic
1008944120 6:57078234-57078256 AAACTTCCTCAACCTGATAAAGG - Intergenic
1010700907 6:79045735-79045757 GAGCATGGTTAAACAGATAAGGG + Intronic
1011206161 6:84901168-84901190 TAGCATTCTCAACTTAATAAAGG - Intergenic
1011499534 6:87972744-87972766 GAGCATGCTCAGCCTGAGCTGGG + Intergenic
1012662179 6:101914307-101914329 GAGCATGATCAATTTGATATTGG + Intronic
1012970378 6:105723076-105723098 GAACTTCCTCAACCTGATATGGG + Intergenic
1016405961 6:143731071-143731093 GAACTTCCTCAACCTAATAAAGG - Intronic
1016516805 6:144902454-144902476 GAACTTCCTCAACATGATAAAGG - Intergenic
1016601830 6:145870799-145870821 GAACTTCCTCAACCTGATAAAGG - Intronic
1016929836 6:149393678-149393700 GAGAATGCTCAACCTTATCCTGG + Intronic
1018543465 6:164909924-164909946 AAACTTCCTCAACCTGATAAAGG + Intergenic
1018591274 6:165425527-165425549 GAATTTCCTCAACCTGATAAAGG + Intronic
1019061099 6:169258866-169258888 GTCCATGCACAACCTGACAACGG - Intergenic
1019061727 6:169262323-169262345 GTCCATGCACAACCTGACAACGG + Intergenic
1019302490 7:314289-314311 AAAGTTGCTCAACCTGATAAAGG - Intergenic
1019782363 7:2950432-2950454 AAACTTCCTCAACCTGATAAAGG - Intronic
1020871454 7:13634736-13634758 GAACATATTCAACCTGATTATGG + Intergenic
1020917959 7:14221326-14221348 GAGAGTACTCAACCTGATAAAGG - Intronic
1022116917 7:27269176-27269198 GAACTTTCTCAAACTGATAAAGG - Intergenic
1022401206 7:30040022-30040044 GAACTTCTTCAACCTGATAAAGG - Intronic
1022646519 7:32235095-32235117 GTGCATCCTTACCCTGATAAAGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023423499 7:40009770-40009792 GAACTGCCTCAACCTGATAAAGG + Intronic
1024011977 7:45275032-45275054 GAACTTCCTCAACCTTATAAAGG - Intergenic
1024203924 7:47136314-47136336 AATCTTTCTCAACCTGATAAGGG - Intergenic
1024299030 7:47871766-47871788 GAACATCCTCAATCTGATAACGG + Intronic
1024457071 7:49620795-49620817 GAGCTTCCTTAACCTGATAGGGG + Intergenic
1025119659 7:56290266-56290288 GAGCTTTCTCCACCTGAGAATGG + Intergenic
1025939492 7:66064359-66064381 GAACTTCCTCAAACTGATAAAGG + Intergenic
1026021820 7:66713663-66713685 GAACTTCCTCAACCTGATAAAGG - Intronic
1026393211 7:69924092-69924114 GAACATTCTCAACCTAATAAAGG - Intronic
1026886235 7:73948228-73948250 GAACTTCCTCAACCTGATAAAGG - Intergenic
1027443985 7:78251224-78251246 CAACTTTCTCAACCTGATAAAGG + Intronic
1028543820 7:91975795-91975817 GAACCTCCTCAATCTGATAAAGG - Intronic
1028931386 7:96416266-96416288 CAGAATGCTCAACCTAATGAGGG - Intergenic
1030013409 7:105194238-105194260 GATCCATCTCAACCTGATAAAGG + Intronic
1031463050 7:122075576-122075598 AAACTTCCTCAACCTGATAAAGG - Intergenic
1032791300 7:135244958-135244980 GAGCTTTGTTAACCTGATAAAGG - Intronic
1033028274 7:137798996-137799018 GAACGTCCTCAACCTAATAAAGG + Intronic
1034639049 7:152587606-152587628 GTGCTTCCTCAACCTGAAAAGGG - Intergenic
1036072430 8:5456082-5456104 TACCGTGCTCAACCTGTTAAGGG - Intergenic
1036598364 8:10236116-10236138 AAACTTTCTCAACCTGATAAAGG + Intronic
1036734163 8:11294391-11294413 GAACTTCCTCAACCTGATAAGGG - Intronic
1037699296 8:21259336-21259358 GAAATTTCTCAACCTGATAAAGG + Intergenic
1038582521 8:28761669-28761691 GAACATACTCAACCTGATAAAGG - Intergenic
1038719865 8:30025486-30025508 GAACTTCCTCAACCTGATCAAGG + Intergenic
1038752540 8:30309732-30309754 GAACTTTCTCAACTTGATAATGG - Intergenic
1038862935 8:31407276-31407298 GAACTTCCTCAGCCTGATAAAGG + Intergenic
1039730656 8:40272994-40273016 GAACACTCTCAACCTTATAAAGG - Intergenic
1040632181 8:49227915-49227937 AAACATCTTCAACCTGATAAAGG + Intergenic
1041474847 8:58252812-58252834 GAACATCCTCAACCTAATAAAGG + Intergenic
1041604519 8:59765027-59765049 GAACTTCCTCAACCTAATAAAGG + Intergenic
1042152856 8:65807676-65807698 GAACTTCCTCAACCTGATAAAGG - Intronic
1042609364 8:70580540-70580562 GAACTTCCTCAACCTGATAAAGG + Intronic
1043493276 8:80771834-80771856 GAACTTCCTAAACCTGATAAAGG - Intronic
1043651680 8:82602086-82602108 AAACTTCCTCAACCTGATAAAGG - Intergenic
1044730662 8:95226322-95226344 GAGGATGCACAACCTGATCCAGG + Intergenic
1045974450 8:108115706-108115728 TTGCATGCTCAATTTGATAAAGG - Intergenic
1049078381 8:140419484-140419506 GAATGTTCTCAACCTGATAAAGG + Intronic
1049678988 8:143908203-143908225 GAACCTCCTCAACCGGATAAAGG - Intergenic
1050639256 9:7649040-7649062 GAATTTCCTCAACCTGATAATGG + Intergenic
1050689822 9:8213914-8213936 GAGCCTCATCAACCTGAGAATGG - Intergenic
1051019674 9:12527467-12527489 GAACTTTTTCAACCTGATAAAGG - Intergenic
1051326683 9:15979436-15979458 GAACATCTTCAACCTGATAAAGG - Intronic
1051577135 9:18629394-18629416 GAACTTCCTCAATCTGATAAAGG - Intronic
1052823026 9:33154335-33154357 GAACTTCCTCAACCTGATAAAGG + Intronic
1053035003 9:34818326-34818348 GAACTTCCTCAACATGATAAAGG - Intergenic
1055384876 9:75749830-75749852 CATCTTCCTCAACCTGATAAAGG + Intergenic
1055545119 9:77363246-77363268 GAACTTCCTCAACCTGAAAAAGG - Intronic
1055624162 9:78156318-78156340 GAACTTCCTCAACCTGAAAAAGG - Intergenic
1056375452 9:86005329-86005351 GAGCTTCCTAAACCTGATAAAGG + Intronic
1056482852 9:87023467-87023489 GAACTTCCTCAACCTGATAAAGG + Intergenic
1056703289 9:88929371-88929393 GAACTTCCCCAACCTGATAAAGG - Intergenic
1058782926 9:108356844-108356866 GATCTTCTTCAACCTGATAAAGG + Intergenic
1059144020 9:111881499-111881521 GAACTTCCTCAACCTGATAAGGG + Intergenic
1059186756 9:112280529-112280551 GAACATTTTCAACCTGATAAAGG - Intronic
1059358618 9:113720688-113720710 GAACTTCCTCAACATGATAAAGG + Intergenic
1060731870 9:126043427-126043449 TAACTTCCTCAACCTGATAAAGG - Intergenic
1186694207 X:12012373-12012395 GAACTTCCTCAACCTGGTAAAGG - Intergenic
1187451828 X:19403865-19403887 GAACTTCCTCAATCTGATAAAGG + Intronic
1187699579 X:21952264-21952286 GAGCTTTCTCAACTTGATAAAGG - Intronic
1188327882 X:28829487-28829509 GAACTTCCTCAACTTGATAAAGG - Intronic
1189082093 X:37984968-37984990 GAACTTCCTCAACTTGATAAAGG + Intronic
1189699648 X:43704480-43704502 GAACTTCCTCAACCTAATAAAGG + Intronic
1189742828 X:44138572-44138594 GAGCTTGCTAAGCCTGATAAAGG + Intergenic
1190257948 X:48778205-48778227 GAACTTCCTCAACCTGATAAAGG + Intergenic
1190423194 X:50306618-50306640 GAGGTTCCTCAACCTGATAAAGG - Intronic
1190891731 X:54574280-54574302 GAACTTCCTCAGCCTGATAAAGG - Intergenic
1190901765 X:54681861-54681883 GAATTTTCTCAACCTGATAAAGG - Intergenic
1192197707 X:69040552-69040574 GAGCTTCCTCAACCTGGCAAAGG - Intergenic
1192332587 X:70188946-70188968 GAACTTCCTCAACCTGATAAAGG + Intronic
1192336399 X:70223923-70223945 GAGCATGCTTAACTTGTTCAAGG - Intergenic
1192382516 X:70633380-70633402 GAACTCCCTCAACCTGATAAAGG + Intronic
1192391638 X:70734828-70734850 GAGCTTCCTCAACCTGACAAAGG + Intronic
1192781797 X:74301649-74301671 GAGCTTTCTCAATCTGGTAAAGG + Intergenic
1193023503 X:76818933-76818955 GAACTTCCTCAACCAGATAAAGG - Intergenic
1193109264 X:77711189-77711211 GAACTTCCTCAACTTGATAAAGG + Intronic
1195196971 X:102507606-102507628 GAACTTCCTCAACCTAATAAAGG + Intergenic
1195209912 X:102644947-102644969 GAACTTCCTCAACTTGATAAAGG - Intergenic
1195634157 X:107094524-107094546 GAGCATCTTCAACCTGCTTATGG + Intronic
1195933192 X:110100319-110100341 GAACTTCCTCAGCCTGATAAAGG - Intronic
1195999941 X:110771669-110771691 GTACTTCCTCAACCTGATAAAGG + Intronic
1196182586 X:112708972-112708994 GAACATCATCAACTTGATAATGG - Intergenic
1196700972 X:118668239-118668261 GATCTTCCTCAATCTGATAAGGG - Intronic
1197436517 X:126434930-126434952 GAACTTCCTCAATCTGATAAAGG + Intergenic
1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG + Intergenic
1197982609 X:132233187-132233209 GAACATCCTCAAATTGATAAAGG - Intergenic
1198501123 X:137247796-137247818 AATCTTCCTCAACCTGATAATGG + Intergenic
1198854017 X:140996586-140996608 GAGCAAGGTCAAACTCATAAGGG - Intergenic
1199751220 X:150820512-150820534 GAATTTCCTCAACCTGATAAAGG + Intronic
1199773607 X:150991446-150991468 GAACTTCCTCAACCTGATATAGG + Intergenic
1199811112 X:151350056-151350078 GAACTTCCCCAACCTGATAAAGG + Intergenic
1200315993 X:155133876-155133898 GAACTTCCCCAACCTGATAAAGG + Intronic
1200376882 X:155791523-155791545 GAACTTCCTCAACCTGATAAAGG + Intergenic
1200387329 X:155906960-155906982 AAACTTCCTCAACCTGATAAAGG - Intronic
1202391597 Y:24376081-24376103 GAACTTCCTCAACCAGATAAAGG + Intergenic
1202479188 Y:25294036-25294058 GAACTTCCTCAACCAGATAAAGG - Intergenic