ID: 1132220292

View in Genome Browser
Species Human (GRCh38)
Location 15:100100253-100100275
Sequence TCGAAGAAGCAAGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 381}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132220292_1132220300 5 Left 1132220292 15:100100253-100100275 CCTCCCTCCTCTTGCTTCTTCGA 0: 1
1: 0
2: 0
3: 29
4: 381
Right 1132220300 15:100100281-100100303 TGAAAGTGGGTAGCTCCCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1132220292_1132220299 4 Left 1132220292 15:100100253-100100275 CCTCCCTCCTCTTGCTTCTTCGA 0: 1
1: 0
2: 0
3: 29
4: 381
Right 1132220299 15:100100280-100100302 GTGAAAGTGGGTAGCTCCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 89
1132220292_1132220301 6 Left 1132220292 15:100100253-100100275 CCTCCCTCCTCTTGCTTCTTCGA 0: 1
1: 0
2: 0
3: 29
4: 381
Right 1132220301 15:100100282-100100304 GAAAGTGGGTAGCTCCCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 83
1132220292_1132220297 -8 Left 1132220292 15:100100253-100100275 CCTCCCTCCTCTTGCTTCTTCGA 0: 1
1: 0
2: 0
3: 29
4: 381
Right 1132220297 15:100100268-100100290 TTCTTCGACTCCGTGAAAGTGGG 0: 1
1: 0
2: 0
3: 18
4: 71
1132220292_1132220296 -9 Left 1132220292 15:100100253-100100275 CCTCCCTCCTCTTGCTTCTTCGA 0: 1
1: 0
2: 0
3: 29
4: 381
Right 1132220296 15:100100267-100100289 CTTCTTCGACTCCGTGAAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132220292 Original CRISPR TCGAAGAAGCAAGAGGAGGG AGG (reversed) Intronic
900655863 1:3756665-3756687 TCGAAGACGCCAGAGGAGCTCGG + Intronic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
901447912 1:9319415-9319437 GAGAAGGAGGAAGAGGAGGGAGG - Intronic
902764686 1:18606437-18606459 TGGAAGAAGCAGGAGGGGTGGGG + Intergenic
903202841 1:21756538-21756560 TCCAAGAAGAAAAAGGTGGGTGG - Exonic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903676539 1:25068050-25068072 AGGAAGAACCAGGAGGAGGGTGG - Intergenic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
908258119 1:62318989-62319011 TGGCAGAGGCAAGAGGAGAGTGG + Intronic
908413264 1:63887297-63887319 CTGAAGAAAGAAGAGGAGGGTGG + Intronic
909253658 1:73390568-73390590 TAGAAGAAGAAGGAGGAAGGAGG - Intergenic
910150149 1:84133117-84133139 TGGAAGAAGCAAGAGCTTGGAGG + Intronic
911137676 1:94458873-94458895 GCTAAGAAGCTAGAAGAGGGGGG - Intronic
911557016 1:99356799-99356821 TCCAAAAAGCAAGAGGTGAGAGG - Intergenic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
912467883 1:109886482-109886504 TCAGAGCAGCAAGAGGTGGGAGG + Intergenic
912816480 1:112832823-112832845 TCCCAGAAGCAAGAGGAGGAAGG + Intergenic
913417046 1:118620050-118620072 TGGCAGAAGCAAGAGGAAGTGGG - Intergenic
914351900 1:146847230-146847252 TTGAAGAAGGAAAAGGTGGGAGG - Intergenic
915580801 1:156812159-156812181 TCCAGGAGGCATGAGGAGGGTGG - Intronic
915580896 1:156812686-156812708 TCCAGGAGGCATGAGGAGGGTGG + Intronic
916738714 1:167630208-167630230 ACGAGGAAGGAGGAGGAGGGAGG - Exonic
917285718 1:173419608-173419630 TCACAGAAGAGAGAGGAGGGTGG + Intergenic
917662541 1:177191427-177191449 TGAAAGAAAAAAGAGGAGGGAGG - Intronic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
919143552 1:193604241-193604263 TGAAAAAAGCCAGAGGAGGGTGG + Intergenic
919688969 1:200511532-200511554 TCCAAGAACCTAAAGGAGGGTGG + Intergenic
920056387 1:203195795-203195817 TCAGAGGAGCCAGAGGAGGGTGG + Intergenic
920091579 1:203456768-203456790 TCAGAGAAGTAAGAGGAGTGGGG + Intergenic
921511656 1:216038490-216038512 TAGAATAAGAAAGTGGAGGGGGG - Intronic
923097289 1:230785548-230785570 TGGAAAAAGCAGGAGCAGGGTGG - Intronic
923420168 1:233806213-233806235 TGGAAAAAGCAAAAGTAGGGAGG + Intergenic
923626164 1:235615732-235615754 TCCAAGAAGCACCAGGAGGAGGG + Intronic
924162262 1:241245348-241245370 CGGCAGGAGCAAGAGGAGGGGGG - Intronic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1064040789 10:11961498-11961520 CAGAAGAGGGAAGAGGAGGGAGG + Intronic
1064395907 10:14981838-14981860 CCAAAGAAGCAAGGGAAGGGGGG - Intronic
1064681536 10:17815358-17815380 TGGAAGAAGAAAGAGCAGTGTGG + Intronic
1066046382 10:31599057-31599079 GAGAGGAAGCAAGAGGTGGGGGG - Intergenic
1067446661 10:46353834-46353856 TCAAAGAAGCAATATGAGGCTGG + Intergenic
1067539948 10:47144027-47144049 TGGATGGAGCAAGAGGTGGGGGG - Intergenic
1067557813 10:47284874-47284896 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067557819 10:47284894-47284916 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067590723 10:47506933-47506955 TCAAAGAAGCAATATGAGGCTGG - Intronic
1067637841 10:48015032-48015054 TCAAAGAAGCAATATGAGGCTGG - Intergenic
1069291552 10:66786371-66786393 GGGTAGAAGCAAGAGGAGGAAGG - Intronic
1070134438 10:73679456-73679478 TCAAAGAAGCAATATGAGGCTGG - Intronic
1070342996 10:75514668-75514690 ACAAAGGAGCAAGAGGAGGAGGG - Intronic
1070379739 10:75869976-75869998 ACGAAGCAGCAAGAGGGGAGAGG - Intronic
1070902934 10:80046721-80046743 TAGAAGAAGGAAGGGGAAGGGGG + Intergenic
1072085631 10:92076758-92076780 TAGAAGAAGGAAGAAGAAGGAGG + Intronic
1072141613 10:92593400-92593422 GCGAAGAAGAAAGAGGAGAAGGG + Exonic
1072268941 10:93756808-93756830 TCTAAGAAGCTAGAGGAGAAAGG + Intergenic
1072451366 10:95541814-95541836 TTGAAGGACCAATAGGAGGGAGG - Intronic
1072982922 10:100114914-100114936 CTGCAGAAGCTAGAGGAGGGGGG - Intergenic
1073402704 10:103271957-103271979 ATCAAGAAGCAAGGGGAGGGGGG + Intergenic
1073415617 10:103379253-103379275 TCCAAGAAGGAAGAAGGGGGAGG + Intronic
1073523000 10:104152385-104152407 TGGCAGAGGCATGAGGAGGGAGG + Intronic
1073580780 10:104663817-104663839 TAAAAGAAGAAAGAGGAGTGGGG - Intronic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075087474 10:119423142-119423164 TGGAAGAAGGAAGGGAAGGGAGG - Intronic
1075382664 10:122031702-122031724 TCGAAAAAGAAAAAGGAGGCTGG - Intronic
1075480225 10:122774526-122774548 TGGAAGAGGAAAGAGGAGGCTGG - Intergenic
1075935469 10:126337362-126337384 TCAAAGCAGGAAGAGGAAGGTGG - Intronic
1076222472 10:128745633-128745655 CAGAAGATGCAAGAGGAGGGAGG + Intergenic
1076707213 10:132308368-132308390 ACGAAGAAGGCAGGGGAGGGAGG - Intronic
1076714155 10:132354795-132354817 TGGGAGAAACAAGAGGAGGCCGG + Intronic
1078729472 11:13962648-13962670 GCGAAGGAGCGGGAGGAGGGAGG - Intergenic
1079347254 11:19663750-19663772 TCCAAGATGGAAGAGGAGGCTGG - Intronic
1080117655 11:28638844-28638866 CCGAAGAAGCACAAGGAGTGGGG + Intergenic
1081436051 11:43028470-43028492 CTGAAGAAGCAAGTGGAAGGAGG - Intergenic
1081556412 11:44166396-44166418 TCTAAGAAGCAGTAGCAGGGAGG + Intronic
1081751926 11:45517514-45517536 TCCCAGAAGCCAGAGCAGGGAGG + Intergenic
1081762560 11:45586569-45586591 TCAAAGAAGGCAGAGGAGAGGGG + Intergenic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1084452680 11:69249412-69249434 TCAAAATAGCAAGAGAAGGGAGG - Intergenic
1084811159 11:71612426-71612448 CCAAAGAAGCAAGGGAAGGGGGG + Intergenic
1085473171 11:76771204-76771226 TGGAAGGGGCAGGAGGAGGGAGG - Intergenic
1086518886 11:87646424-87646446 TCAAAGAAGAAAGAAGAAGGAGG - Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086853025 11:91833526-91833548 TGGAAGAAGGGAGAGGAGGAGGG + Intergenic
1087786232 11:102357273-102357295 AGGAAGAAGGAAGAAGAGGGAGG - Intronic
1088182904 11:107132284-107132306 TCAGGGAAGAAAGAGGAGGGAGG + Intergenic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1089319508 11:117615482-117615504 TATAAGAAGCAAGTGCAGGGAGG + Intronic
1089981008 11:122772502-122772524 GGGAAGGAGGAAGAGGAGGGAGG + Intronic
1090446649 11:126770191-126770213 CTGAAGAAGCAAGGGGAGGTGGG - Intronic
1090697969 11:129267868-129267890 GAGAGGAAGCAAGTGGAGGGAGG + Intronic
1091337142 11:134780702-134780724 AAGAAGGAGAAAGAGGAGGGAGG - Intergenic
1091446366 12:546139-546161 GGGAAGAGGGAAGAGGAGGGGGG + Intronic
1091446471 12:546614-546636 TGGAAGAGAGAAGAGGAGGGAGG - Intronic
1091799384 12:3315315-3315337 TCACAGAAGCAGGTGGAGGGAGG + Intergenic
1092067426 12:5603496-5603518 TAGAAGAAGAAAGAGAAAGGTGG + Intronic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1094443830 12:30508094-30508116 CCGAAGAACAAAGAGGAGGATGG - Intergenic
1095960338 12:47830496-47830518 TGGAAGAGGAAAGAGGAAGGTGG - Intronic
1095961362 12:47836226-47836248 TGGAAGATGCAAGAGCAGGAGGG + Intergenic
1096024719 12:48350847-48350869 TCCCAGACGCAAGCGGAGGGCGG - Intronic
1097990073 12:65824954-65824976 TGGAGGTAGCAAGAGGAGGAGGG - Exonic
1098377415 12:69831958-69831980 TTGAAGAATAAAGAGGAGGCTGG + Intronic
1098799532 12:74936447-74936469 TAGAAGAAGCAAGAGCAAGTTGG + Intergenic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1099195371 12:79609068-79609090 TCAAAAAAACAAAAGGAGGGGGG + Intronic
1101253673 12:102957536-102957558 AGGAAGAGGTAAGAGGAGGGGGG + Intronic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102413784 12:112742998-112743020 TGGCAGAAGCAAGAGGTTGGAGG - Intronic
1102653904 12:114463807-114463829 CAGAAGAATCAAGTGGAGGGTGG - Intergenic
1102893914 12:116583060-116583082 TCAAAGAAGGAGGAGGAGGGTGG + Intergenic
1103073943 12:117967543-117967565 TCTAAGGAGCAAAAGGAGGGAGG + Intronic
1103147588 12:118609053-118609075 ACGAAGAAGGAAGAGCAGGGAGG + Intergenic
1104092698 12:125529078-125529100 AAGAAGAAGGAAGAGGAAGGAGG - Intronic
1104891618 12:132142943-132142965 TGGAAAAAGCTAGGGGAGGGAGG + Intronic
1105694612 13:22875568-22875590 TGGAAGAAACAAAAGGAGGGAGG + Intergenic
1105779704 13:23695694-23695716 TCGAAGAAGCCACAGCAGGGAGG - Intergenic
1105949823 13:25219624-25219646 TGGAAGAAGAAAGTGGAGTGAGG - Intergenic
1106599709 13:31177103-31177125 GGAAAGAAGCAAGAGAAGGGAGG - Intergenic
1107187113 13:37536540-37536562 GCAAAGAAGCAAGAGGCTGGAGG + Intergenic
1107579372 13:41765994-41766016 TCGCAGAAGCAGGAGTAGGGCGG + Intronic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108404075 13:50082100-50082122 TCGGGAAAGCAAGAGAAGGGGGG - Intergenic
1108475019 13:50807402-50807424 TGAGAGAAGCAGGAGGAGGGAGG - Intronic
1109119828 13:58440715-58440737 TCACAGGATCAAGAGGAGGGTGG - Intergenic
1111446119 13:88347863-88347885 TGGAGGAAGGAAGGGGAGGGAGG + Intergenic
1113167631 13:107460171-107460193 TCAAAGAAGCAAGAGTGGGAGGG + Intronic
1114043705 14:18703110-18703132 TAAAAGAAATAAGAGGAGGGGGG + Intergenic
1114047992 14:18893552-18893574 TAAAAGAAATAAGAGGAGGGGGG + Intergenic
1114116223 14:19625854-19625876 TAAAAGAAATAAGAGGAGGGGGG - Intergenic
1116255844 14:42554261-42554283 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
1117185275 14:53233779-53233801 TGGAACAAGAGAGAGGAGGGAGG + Intergenic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118035977 14:61866296-61866318 CCAAAAAAGGAAGAGGAGGGTGG + Intergenic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1120513038 14:85438485-85438507 TCTGAGAAGAAGGAGGAGGGCGG + Intergenic
1122072109 14:99211634-99211656 TCGAGGAACCAGGTGGAGGGGGG - Intronic
1122846553 14:104503217-104503239 GAGAAGAAGCAAGATGGGGGAGG - Intronic
1124957744 15:34370803-34370825 AGGAAGAAGGAAGAAGAGGGAGG - Intergenic
1124999242 15:34754217-34754239 TAGGAGTAGCTAGAGGAGGGGGG + Intronic
1128056923 15:64706606-64706628 TCGAGGAAGTGAGAGGAGCGTGG - Intergenic
1130226000 15:82058839-82058861 TAGAGAAAGGAAGAGGAGGGAGG - Intergenic
1130520435 15:84657460-84657482 TGGAAGCACCAAGAGGAGGAAGG - Intronic
1131014152 15:89043509-89043531 AGGAAGGAGGAAGAGGAGGGAGG + Intergenic
1131140938 15:89976699-89976721 TATAAGAAGCAAGATGAGGCTGG + Intergenic
1131317512 15:91352934-91352956 GAGAAGAGGCAAGAGCAGGGAGG - Intergenic
1131488431 15:92841463-92841485 TGGAGGAAGCAGGAGCAGGGAGG - Intergenic
1132220292 15:100100253-100100275 TCGAAGAAGCAAGAGGAGGGAGG - Intronic
1132828255 16:1915571-1915593 TTAGAAAAGCAAGAGGAGGGTGG - Intronic
1133510719 16:6454781-6454803 GGGAAGAAGCAAGGGGAGGGAGG - Intronic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1134287182 16:12872038-12872060 AGGAAGAAGAAGGAGGAGGGGGG - Intergenic
1135942428 16:26834220-26834242 AAGAAGAAGGAAGAGGAGGGAGG + Intergenic
1137378902 16:47979487-47979509 TAAAAGAGGCAGGAGGAGGGAGG - Intergenic
1137555323 16:49466856-49466878 TAGAAGTTGCAAGAGGAGGAAGG + Intergenic
1138153952 16:54685826-54685848 AGGAAGAAGGAAGAGGAGGAGGG - Intergenic
1139946326 16:70644893-70644915 AGGAAGGAGGAAGAGGAGGGAGG + Intronic
1139982133 16:70868306-70868328 TTGAAGAAGGAAAAGGTGGGAGG + Intronic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1141163986 16:81648034-81648056 TGGAAGCAGCAGGGGGAGGGTGG - Intronic
1141198949 16:81882656-81882678 TCGAGGAAAAAAGAGAAGGGAGG - Intronic
1141713983 16:85716520-85716542 GGGGAGAAGGAAGAGGAGGGAGG + Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141789278 16:86223080-86223102 TAGAAAAAGCAAGAGGCTGGAGG - Intergenic
1143058704 17:4181947-4181969 ACCAAGAAGCAAGAGAATGGCGG - Intronic
1143131719 17:4682685-4682707 TTGAAGAAGTGAGAAGAGGGAGG - Intronic
1143325323 17:6094761-6094783 TGGCAGAAGCAAGAGAAGGAAGG + Intronic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1145934780 17:28708641-28708663 TCAGAGAGGCAAGAGGCGGGAGG + Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1148925563 17:51081840-51081862 TCAAAGAAGTAAGAGAATGGTGG - Intronic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149333098 17:55606727-55606749 CTGACGAAGGAAGAGGAGGGAGG - Intergenic
1149333107 17:55606805-55606827 TTTAAGAAGCAGGAGGAAGGAGG - Intergenic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151592050 17:75051641-75051663 TGGGAGAGGCAAGAGGATGGGGG - Intronic
1151947536 17:77327727-77327749 TAGAAAAAAAAAGAGGAGGGTGG - Intronic
1152418082 17:80175874-80175896 GCCAGGAAGCAGGAGGAGGGTGG - Intronic
1153876913 18:9382199-9382221 TAGAAAAAACAAGAGGAGGCTGG + Intronic
1156040698 18:32817963-32817985 TCAAAGAAGCAAAATGTGGGGGG + Intergenic
1156284403 18:35676654-35676676 TAAAGGAAGAAAGAGGAGGGTGG + Intronic
1156368508 18:36451601-36451623 GAGGAGAAGGAAGAGGAGGGAGG - Intronic
1156713920 18:39983018-39983040 TGGAAGAAGGAAGAGAAGGAGGG + Intergenic
1156741488 18:40335543-40335565 TATAAGAAGCAAGAGGATAGTGG - Intergenic
1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG + Intronic
1158707628 18:59807488-59807510 TGGAAGCAGCCAGAGGAAGGAGG - Intergenic
1159072350 18:63640118-63640140 TAAAAGTAGGAAGAGGAGGGAGG - Intronic
1160114740 18:76066904-76066926 TGGAAGGAGCGAGAGGAGGTTGG - Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160354514 18:78215811-78215833 TTGAAGCTGCAAGTGGAGGGTGG + Intergenic
1160829461 19:1096536-1096558 CGGAAGAAGAAAGAGCAGGGAGG + Intergenic
1161039653 19:2103448-2103470 TGGAAGAAGCCAGTGGAGTGGGG + Intronic
1161638110 19:5401931-5401953 GGGAAGAAGGAAGAGGGGGGAGG + Intergenic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1165761563 19:38324537-38324559 TCCAGCCAGCAAGAGGAGGGAGG + Intronic
1166038602 19:40188534-40188556 TCAAAGAAGCAAATAGAGGGTGG - Intergenic
1166209742 19:41298601-41298623 ACGAAGGAGTAAGTGGAGGGAGG + Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167268471 19:48494727-48494749 TGGCAGGGGCAAGAGGAGGGTGG + Intronic
926574462 2:14564708-14564730 AAGAAGAAGAAACAGGAGGGAGG + Intergenic
927091137 2:19713589-19713611 TCCAGGAAGAAAGAGGAGGGAGG + Intergenic
928138505 2:28707198-28707220 TGTAAGAAGCCAGAGGAGTGAGG - Intergenic
929014249 2:37478754-37478776 TGGAAGAAGCCAGAGGTTGGAGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931564537 2:63601673-63601695 TAGAAGGAGCAAGAGGAGGAGGG + Intronic
931635510 2:64337713-64337735 GCCAAGAAGCAACAGGAGGTGGG + Intergenic
932514639 2:72333478-72333500 TCTGAGAAGAAACAGGAGGGTGG + Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933164789 2:79064140-79064162 TGGCAGAAGTAAGAGGAAGGGGG - Intergenic
933488659 2:82955954-82955976 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
935635749 2:105248566-105248588 GCAGAGAGGCAAGAGGAGGGTGG + Intergenic
936122498 2:109758944-109758966 GGGAAGAAAAAAGAGGAGGGAGG + Intergenic
936222195 2:110612528-110612550 GGGAAGAAAAAAGAGGAGGGAGG - Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
938079910 2:128364483-128364505 TGGAAGGAGCAAGAGGAGAAGGG - Intergenic
938425368 2:131182065-131182087 TAAAAGAAATAAGAGGAGGGGGG + Intronic
938681517 2:133696500-133696522 TGGAAGAGGCAAGAGTAGAGAGG - Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
940927461 2:159381040-159381062 TTCAAGAAGCAAGAGCAGAGAGG - Intronic
945043956 2:205765622-205765644 TGGGATAAGCAAGAGGAGGCAGG + Intronic
946241979 2:218361929-218361951 TCTCAGAAGCAAGAGGCAGGAGG + Intronic
946917541 2:224540423-224540445 GGGAAGAAGGAAGAGGAAGGAGG + Intronic
947594616 2:231403150-231403172 TCAAAGAGGCAAGGGAAGGGGGG + Intergenic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948342238 2:237263083-237263105 AGGAAGAAGCGAGAGGCGGGAGG - Intergenic
1169334295 20:4742679-4742701 GAGAGGAGGCAAGAGGAGGGAGG - Intergenic
1170178706 20:13503115-13503137 TAGGAGAAGGAAGGGGAGGGAGG + Intronic
1170758748 20:19230538-19230560 GCAAAGAAGCAAAAGGAGGGTGG - Intronic
1173525424 20:43729039-43729061 TAGAAGAAGGAAGAGGATGTGGG + Intergenic
1174317243 20:49713015-49713037 TAGAGGAAGAAAGGGGAGGGAGG + Intronic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175496679 20:59419339-59419361 ACAGAGAAACAAGAGGAGGGAGG + Intergenic
1177420429 21:20849699-20849721 GGGCAGAAGCAAGAGAAGGGAGG + Intergenic
1177689586 21:24488118-24488140 TGGAAGAAGAAAGAGGAGAGTGG + Intergenic
1180466527 22:15616228-15616250 TAAAAGAAATAAGAGGAGGGGGG + Intergenic
1182243087 22:28932932-28932954 TAGAAGAAGGGAGAGGAAGGGGG - Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182875474 22:33687737-33687759 TGGAAGACGGAAGAGGTGGGAGG + Intronic
1183526501 22:38326212-38326234 CTGAAGATGGAAGAGGAGGGAGG - Intronic
1183594000 22:38798707-38798729 TCATAGAACCAAAAGGAGGGAGG - Intergenic
1184325512 22:43780693-43780715 TCTAAGGAGAAAGAGGAGAGTGG - Intronic
1184856359 22:47148742-47148764 GAGAAGAACCCAGAGGAGGGAGG - Intronic
1185056917 22:48585999-48586021 TGGAGGAAGGGAGAGGAGGGTGG + Intronic
1185145946 22:49136727-49136749 TCACAGAAGCCACAGGAGGGAGG + Intergenic
1185156229 22:49195100-49195122 TAGAACAAGCAAGGTGAGGGAGG - Intergenic
949549904 3:5104155-5104177 TCGAAGGAGGAAGAGGACTGGGG - Intergenic
949882664 3:8674205-8674227 CCAAAGAAGCAAGGGAAGGGGGG + Intronic
950520492 3:13495113-13495135 TGGAAGGAGCAGGTGGAGGGAGG - Intronic
950796169 3:15512143-15512165 TCAAAGAAGGAAGAGGAGAGTGG + Intronic
951033822 3:17911101-17911123 AGGAAGAAGCAAGAGGAAGAAGG - Intronic
952277857 3:31894936-31894958 TCTAAAAAGCAAGTGGAGGAGGG - Intronic
953016671 3:39083435-39083457 CCCAAGAAGCAAGAGGTGAGGGG + Intronic
953363936 3:42325633-42325655 TTGTAGAAGCAAAAGGAGAGAGG - Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
955160181 3:56457805-56457827 TGGAATTAGCCAGAGGAGGGAGG - Intronic
955516640 3:59732482-59732504 TTAAAGAAACAAGAGGAAGGCGG - Intergenic
956408835 3:68957494-68957516 TCCAAGAATTAAGAGGTGGGAGG + Intergenic
957022120 3:75138601-75138623 CCGAAGGAGCAAGAGAAGGGGGG + Intergenic
957589517 3:82177554-82177576 TGGTAGAAGAAATAGGAGGGGGG - Intergenic
958193060 3:90207982-90208004 ATGAAGAAGTAAGGGGAGGGAGG - Intergenic
958416361 3:93878934-93878956 ATGAAGAAGTAAGGGGAGGGAGG - Intronic
958932028 3:100217458-100217480 TCCAAGAAGTAGGAGGAGGGTGG + Intergenic
960953186 3:123012756-123012778 ATGAAGGAGGAAGAGGAGGGGGG - Intronic
961345538 3:126260954-126260976 GGGGAGAAGGAAGAGGAGGGAGG - Intergenic
961471164 3:127113885-127113907 TGGAAGCAGCCAGGGGAGGGAGG + Intergenic
962047050 3:131771520-131771542 GAGAAGAAGCAAGAGGGGAGAGG - Intronic
962415333 3:135176968-135176990 AAGAGGAAGCAAGCGGAGGGTGG - Intronic
964048226 3:152357697-152357719 TTAAAGAAGCAAGAGTAAGGTGG - Intronic
964369688 3:155986620-155986642 TCAAAGAAACAAGAGTAGGCTGG - Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
967786948 3:193507523-193507545 TCCAAAAAAAAAGAGGAGGGAGG + Intronic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
969020014 4:4133549-4133571 CCAAAGAAGCAAGGGAAGGGGGG - Intergenic
969733842 4:8973864-8973886 CCAAAGAAGCAAGGGAAGGGGGG + Intergenic
969793429 4:9507921-9507943 CCAAAGAAGCAAGGGAAGGGGGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
972341677 4:38157493-38157515 GAGAGGAAGCAAGGGGAGGGAGG + Intergenic
976632627 4:87254393-87254415 TGGAAGAAGCAAGAGAAGGTTGG - Intergenic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
979558946 4:122080473-122080495 GGAAAGAAGAAAGAGGAGGGAGG + Intergenic
979610896 4:122687816-122687838 TTGAAGAACAAAGAGGAGGTTGG + Intergenic
979689646 4:123547093-123547115 ACAAAGAAAGAAGAGGAGGGAGG - Intergenic
979846716 4:125522849-125522871 TCGAAGAAGCAGCTGGACGGTGG + Intergenic
979928242 4:126595096-126595118 CAGAAGAAGCCACAGGAGGGAGG - Intergenic
980445542 4:132902203-132902225 TGAAAGAGGCAAGAGTAGGGAGG + Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981011100 4:139925922-139925944 TGCAAGAAGAAAGAGGAGGACGG + Intronic
982068890 4:151677931-151677953 AGGAAGAAGGAGGAGGAGGGAGG - Intronic
982644352 4:158004860-158004882 TCGAAGAATCCTGAGGAGGATGG - Intergenic
983653166 4:170053614-170053636 TGGAAGAAGAAGGAGGGGGGAGG - Intergenic
984652537 4:182286094-182286116 TCCCAGAAGCAAGAGGTGTGAGG - Intronic
985877750 5:2613183-2613205 TCTGAGACGCAAGAGGAGGCAGG - Intergenic
986266634 5:6196706-6196728 TAGAGGCAGCAAGAGGATGGCGG + Intergenic
988963495 5:36392471-36392493 TGGAGGAAGGAAGAAGAGGGAGG - Intergenic
990866101 5:60381673-60381695 CCGAGGAAGCAAGTGGAGGATGG + Intronic
991272138 5:64796764-64796786 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991272151 5:64796808-64796830 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
992716437 5:79514763-79514785 TCGAACAAGGAAGCGGCGGGAGG + Intergenic
993673788 5:90794099-90794121 TCCAAGAAGGTAGAAGAGGGAGG - Intronic
994913680 5:105945620-105945642 AAGAAGAAGAAAGAAGAGGGAGG + Intergenic
995214732 5:109582348-109582370 GAGGAGAAGGAAGAGGAGGGGGG + Intergenic
997365749 5:133324243-133324265 CCGAAGAGTCAAGGGGAGGGAGG + Intronic
998451146 5:142235594-142235616 GCAAAGGAGCAGGAGGAGGGGGG - Intergenic
998563270 5:143192235-143192257 TCAAAGAAGCCTGAGGAAGGAGG + Intronic
999424784 5:151477765-151477787 TCCAAGAAGGAAGAGGCAGGTGG + Intronic
1001044709 5:168362936-168362958 TAGAAAAAAGAAGAGGAGGGAGG - Intronic
1001171842 5:169426888-169426910 AAGAAGAAGCAAGAGGGTGGGGG + Intergenic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1002685554 5:181006432-181006454 TCAAAGAATAAAGAGGAGGTAGG + Exonic
1003514374 6:6805892-6805914 TCCAGGAAGCAAGAGGAAGGGGG - Intergenic
1004092049 6:12513693-12513715 TGGAAGAAGCAGGAGGATAGAGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004588257 6:17024319-17024341 GAGAGGAAGCAAGAAGAGGGAGG - Intergenic
1004952378 6:20688131-20688153 TGAAAGAAGCCAGAGGTGGGGGG - Intronic
1005303739 6:24494909-24494931 GCGGGGAAGCAAGAGGAGCGAGG - Intronic
1005676029 6:28155930-28155952 TAAAAGAAACAAGAGAAGGGAGG - Exonic
1006304722 6:33212026-33212048 TAGAAGAGGGGAGAGGAGGGAGG + Intronic
1007362063 6:41365741-41365763 TCATAGAAGCAAGAGGAGAATGG - Intergenic
1007656482 6:43454242-43454264 TAGAAGAAGCAAGAGAGGTGAGG + Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1011635040 6:89363911-89363933 TTGAGGATGCAAAAGGAGGGCGG - Intergenic
1012807793 6:103917323-103917345 TCCAAGGAGCAAGAGTAGAGGGG - Intergenic
1014300845 6:119679531-119679553 GCCAAGAAGCAAGAGCAGGATGG + Intergenic
1014751337 6:125260163-125260185 TGGAAGAAAAAAGAGGAGAGAGG + Intronic
1015141067 6:129932385-129932407 GAGAAAAAGAAAGAGGAGGGAGG + Intergenic
1016667367 6:146657652-146657674 TCAGAGAAGAAAGAGGAAGGTGG - Intronic
1016989393 6:149918856-149918878 AGGGAGAAGGAAGAGGAGGGTGG + Intronic
1017004591 6:150020718-150020740 AGGGAGAAGGAAGAGGAGGGTGG + Intronic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1018038045 6:159898542-159898564 AGGAAGAGGCAGGAGGAGGGAGG - Intergenic
1018442822 6:163828783-163828805 TGGAGGAAGCAAGAGAAAGGGGG - Intergenic
1019186508 6:170223683-170223705 TGGAAGGAGAAAGAGGAGAGGGG + Intergenic
1020307419 7:6845584-6845606 CCAAAGAAGCAAGGGAAGGGGGG - Intergenic
1020311891 7:6874410-6874432 TCAAAGAGGCAAGGGAAGGGGGG - Intergenic
1020421006 7:8005385-8005407 TGAAAGCAGCAAGAGGAGGAGGG + Intronic
1020937374 7:14484503-14484525 TAGCAGGAGCAAGAGGTGGGGGG - Intronic
1021336453 7:19408501-19408523 TCAAAGAAGAGAGATGAGGGAGG - Intergenic
1021608770 7:22435874-22435896 TGGCAGAAGCAGGAGTAGGGTGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022812763 7:33885764-33885786 TGGAGGAAGAAATAGGAGGGAGG + Intergenic
1022873494 7:34504001-34504023 GAGCAGGAGCAAGAGGAGGGAGG + Intergenic
1023992196 7:45134909-45134931 TCTAAGAAGACAGAGCAGGGTGG - Intergenic
1024051066 7:45623796-45623818 TCGAAGAGGGAAGGGGAGGAGGG + Intronic
1024346199 7:48316775-48316797 GAGAGGAAGCAAGAGGGGGGAGG + Intronic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1026643877 7:72151243-72151265 TCCAAGAAGCGAGCAGAGGGAGG - Intronic
1027182387 7:75949977-75949999 TCCCAGAAACAGGAGGAGGGAGG - Intronic
1028136065 7:87224070-87224092 AAGAAGAAGCCAGAGGTGGGTGG - Intergenic
1028231070 7:88306916-88306938 TATAAGAAGCCAGAGAAGGGCGG + Intergenic
1029078547 7:97954523-97954545 TCAAAGAAGCAAGGGAAGGGGGG - Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1033236420 7:139641403-139641425 AGGAAGAAGCAAGAGGATTGTGG - Intronic
1035280696 7:157776357-157776379 AGGAAGAAGAGAGAGGAGGGAGG - Intronic
1037907546 8:22724337-22724359 TCAGAGAAGCTAGTGGAGGGGGG + Intronic
1038531817 8:28324450-28324472 TCGCAGAAGAAAGGGAAGGGAGG - Intronic
1039159883 8:34605673-34605695 TCAAAGAAGCAAGAGCAGAATGG - Intergenic
1039390854 8:37179863-37179885 GAGAAGAAGAAAGAAGAGGGAGG - Intergenic
1040942049 8:52844101-52844123 TCCAAGAATCAAAACGAGGGAGG - Intergenic
1041206221 8:55500574-55500596 TGGAAGAGGACAGAGGAGGGTGG - Intronic
1041441776 8:57904792-57904814 GGGAAGAAGCAAGAGGAAGAGGG + Intergenic
1042889335 8:73589969-73589991 GGGAAGAAGAAAGAGGAGGGAGG + Intronic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1044180702 8:89190788-89190810 TGGAGAATGCAAGAGGAGGGAGG + Intergenic
1044597810 8:93975477-93975499 CAGAAGAATCAAGAGGAGAGTGG - Intergenic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1045834863 8:106507965-106507987 AAGAAGAAGCCAGAGGAGGCTGG - Intronic
1047204037 8:122789136-122789158 TGGAGGAAGCAGGCGGAGGGAGG + Intronic
1048284451 8:133130916-133130938 TGGAGGAAGAAAGAGGAGGGGGG + Intronic
1048370746 8:133774018-133774040 TGGGAGAAGGAAGGGGAGGGTGG + Intergenic
1049009389 8:139877221-139877243 TGGAAGAGGCAGGCGGAGGGTGG + Intronic
1049041420 8:140114803-140114825 GCCAAGAGACAAGAGGAGGGAGG + Intronic
1049491723 8:142907455-142907477 GGGAAAAAGGAAGAGGAGGGAGG - Intronic
1050094168 9:2047057-2047079 GGCAAGAAGGAAGAGGAGGGAGG - Intronic
1050234873 9:3566928-3566950 TTGAAGAAGGAAGAGGAGTGGGG + Intergenic
1050315680 9:4398525-4398547 TGGAAGAAGAAAGAAGAAGGAGG - Intergenic
1050386449 9:5096198-5096220 TAGAAGAAATAAGTGGAGGGAGG - Intronic
1052689608 9:31801029-31801051 TAAAAGCAGCAAGAGGAGAGAGG + Intergenic
1053472234 9:38355126-38355148 AGGAAGAAGGAAGGGGAGGGAGG + Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055599371 9:77899634-77899656 TGGAAGAATGAAGAGGTGGGTGG + Intronic
1055759548 9:79591874-79591896 TGAAAGAAGGAAGAGGAGGAGGG + Intronic
1056388307 9:86117451-86117473 GTAAAGAAGGAAGAGGAGGGAGG + Intergenic
1056492410 9:87120610-87120632 TCCAAGAACAAAGGGGAGGGAGG - Intergenic
1058575012 9:106391649-106391671 TTGAAGCAGAAAGAGGTGGGTGG + Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060530878 9:124346481-124346503 GCCAAGAAGCCAGAGCAGGGTGG + Intronic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1060698369 9:125729551-125729573 TCAAAGAAGGAAGAGAAAGGGGG - Intergenic
1185623495 X:1467269-1467291 TGGAGGAAGAAAGAGCAGGGAGG - Intronic
1186093553 X:6075703-6075725 GAGAAGAAGCAAGAGAATGGGGG - Intronic
1186177642 X:6942046-6942068 TCCAAAAGGCAGGAGGAGGGAGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1190828628 X:54041471-54041493 TCTAACAAGCAACAGGAGGAGGG + Intronic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1192550718 X:72051570-72051592 TAGGAGAAGCAAGAGGAAGGAGG - Intergenic
1196639934 X:118047064-118047086 TCAAACAAGTAAGAGAAGGGGGG + Intronic
1196978076 X:121181927-121181949 TGGAAGAAGGAAGTGGTGGGAGG + Intergenic
1197607201 X:128597951-128597973 TAGAAGAAGGAAGAGCAGGGTGG - Intergenic
1197831641 X:130649089-130649111 GAGAGGAAGCAAGAGGAGAGGGG - Intronic
1198806552 X:140500671-140500693 TAAAACAAGGAAGAGGAGGGAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199843146 X:151671244-151671266 TAGCAGAAGGAAGAGGAGAGAGG + Intronic
1200135783 X:153873924-153873946 TCGAGGAAGGGAGAAGAGGGAGG + Intronic
1201300258 Y:12498781-12498803 ACGAAGAAGTAGGAGGAAGGGGG - Intergenic
1201504636 Y:14684512-14684534 GAGAAGAAGCAAGAGAATGGGGG + Intronic
1201541059 Y:15105445-15105467 AAGAAGAAAGAAGAGGAGGGAGG - Intergenic