ID: 1132220718

View in Genome Browser
Species Human (GRCh38)
Location 15:100103101-100103123
Sequence ATGTTCCTGCCTCTTCCATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132220718_1132220723 17 Left 1132220718 15:100103101-100103123 CCGCATGGAAGAGGCAGGAACAT 0: 1
1: 0
2: 3
3: 28
4: 268
Right 1132220723 15:100103141-100103163 CTTCAACCAGAAGTTGTCATGGG 0: 1
1: 0
2: 3
3: 9
4: 116
1132220718_1132220722 16 Left 1132220718 15:100103101-100103123 CCGCATGGAAGAGGCAGGAACAT 0: 1
1: 0
2: 3
3: 28
4: 268
Right 1132220722 15:100103140-100103162 GCTTCAACCAGAAGTTGTCATGG 0: 1
1: 0
2: 0
3: 5
4: 98
1132220718_1132220721 -6 Left 1132220718 15:100103101-100103123 CCGCATGGAAGAGGCAGGAACAT 0: 1
1: 0
2: 3
3: 28
4: 268
Right 1132220721 15:100103118-100103140 GAACATGTGGCTTGGTCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 170
1132220718_1132220724 20 Left 1132220718 15:100103101-100103123 CCGCATGGAAGAGGCAGGAACAT 0: 1
1: 0
2: 3
3: 28
4: 268
Right 1132220724 15:100103144-100103166 CAACCAGAAGTTGTCATGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132220718 Original CRISPR ATGTTCCTGCCTCTTCCATG CGG (reversed) Intronic
900502251 1:3012056-3012078 ATGTGCCTGCCGCTTCCAGCCGG - Intergenic
901293191 1:8140501-8140523 CTGCTCCTGGCCCTTCCATGTGG + Intergenic
902323911 1:15685949-15685971 GTGTTCCTTTCTCTTCCATTAGG - Intronic
903900066 1:26637750-26637772 ATTTTCCTCCTTCTGCCATGTGG + Intergenic
904302740 1:29565808-29565830 AAGTTCCTTCCTCTCCCATCAGG + Intergenic
904855036 1:33491446-33491468 AGGTACCTGCCCCTTCTATGAGG + Exonic
908437876 1:64124469-64124491 TTTTTCCTGCTCCTTCCATGGGG + Intronic
908552769 1:65226183-65226205 ATCTTCCTGGTTCTTCCATTGGG - Exonic
909638742 1:77848193-77848215 CTGTTCATGCCTCTTCCAATGGG - Intronic
910662241 1:89686268-89686290 AAGTACTTGCCTTTTCCATGTGG + Intronic
913140913 1:115940690-115940712 TTGCTCCTGCCTTTGCCATGTGG - Intergenic
915028858 1:152858898-152858920 ATGGTACTGCCTCTACCATATGG - Intergenic
915786145 1:158614371-158614393 AAATTCCTCTCTCTTCCATGTGG - Intronic
918105401 1:181411990-181412012 TTCTTCCTGCCTCTTCCATGAGG + Intergenic
919243789 1:194950931-194950953 ATGTTCCTGCCTATTTGTTGAGG - Intergenic
919579975 1:199359232-199359254 ATATTGCTGCCTATTCCATGTGG + Intergenic
920437527 1:205957133-205957155 CTGTTTCTACCTCGTCCATGAGG + Intergenic
920681098 1:208073375-208073397 AGTTTCCAGCCTCTTCCAGGTGG + Intronic
924553082 1:245096544-245096566 GTCTTCCTGTCTCTCCCATGAGG - Intronic
1062840004 10:662885-662907 GTGTTCACGCCTCTTCCACGTGG - Intronic
1062925164 10:1310785-1310807 CTTTCCCTGCCTCTTCCTTGGGG - Intronic
1063020997 10:2127480-2127502 ATGTTACTGCCTCTTCTCTGTGG + Intergenic
1063189197 10:3678275-3678297 AAAATCCTGCCTCTTCTATGAGG + Intergenic
1063224882 10:4006294-4006316 TGTTTCCTTCCTCTTCCATGGGG + Intergenic
1067524342 10:47029192-47029214 AATTTCCTGCTTCTTCCGTGAGG - Intergenic
1068117799 10:52753022-52753044 CTTTTCCTTTCTCTTCCATGGGG + Intergenic
1069047886 10:63762208-63762230 ATGCTGCTCCCTCTTCCCTGTGG - Intergenic
1069598149 10:69686186-69686208 ATGTCCCTGCCACTTCCTTGAGG + Intronic
1073206508 10:101772231-101772253 AGGATCCTGCCTCTTCCCTGTGG + Intronic
1073736328 10:106351435-106351457 AATTTCCTACCTCTTCCTTGAGG + Intergenic
1074819942 10:117170390-117170412 GTATTCCTGCCTCTAGCATGCGG + Intergenic
1075273823 10:121076112-121076134 AGCTTCCTGCCTCTTCCCTCTGG - Intergenic
1075600224 10:123762032-123762054 GTGTTCCTGCGTCTTCCAGGGGG + Exonic
1076275404 10:129194491-129194513 ATTTTTCTTCTTCTTCCATGAGG + Intergenic
1076439706 10:130472816-130472838 ATGTTCCTGTCTCTGACGTGTGG + Intergenic
1076868096 10:133179202-133179224 ATGCTCCAGCCCCTTCTATGGGG + Intronic
1077227493 11:1444757-1444779 CTGCTCCTGCCTCTCCCAAGTGG - Intronic
1080610690 11:33901241-33901263 AACTTCCTGCCTATTCCATCAGG - Intergenic
1080634785 11:34114215-34114237 ATGTTCCTTCGTCATCCATTAGG - Intronic
1080715471 11:34796049-34796071 ATGTTCCTGTCTCTCCCATTAGG - Intergenic
1080799043 11:35592523-35592545 CTGTTCCTGCCTCTTTCATGTGG - Intergenic
1083773219 11:64879612-64879634 CAGTTCCTGGCTGTTCCATGGGG + Intronic
1084623864 11:70293207-70293229 CTGTTCCTAGCTCTTCCACGTGG + Intronic
1088121618 11:106376955-106376977 ATTTTCCTGCCTCTTAAAAGAGG + Intergenic
1089664987 11:120012735-120012757 ATTTTCCTGCCTCATCCAGTAGG + Intergenic
1091279009 11:134371395-134371417 ATGTTCCTGCCTGTTCCCTTTGG + Intronic
1091281851 11:134386169-134386191 CTGTTCCTGAAGCTTCCATGAGG - Intronic
1092017192 12:5169282-5169304 CCGGTCCTGCCTCTTCCAGGCGG + Intergenic
1092068473 12:5612891-5612913 CTGTACTTGCCTCTTCCATGCGG + Exonic
1094567756 12:31615740-31615762 ATCTTCCTGGTTCTTCCATTGGG + Intergenic
1094811636 12:34143680-34143702 ATGTTGCTGACTCTTGAATGGGG - Intergenic
1096994735 12:55831421-55831443 AAGTCCCTGCTTATTCCATGAGG + Intergenic
1097677379 12:62617340-62617362 AATTTTCTGCCTATTCCATGGGG - Intergenic
1099884781 12:88514869-88514891 TTCTTCCTGCACCTTCCATGAGG + Intronic
1100059459 12:90556007-90556029 ATTTTCCTGCCTCTATCTTGTGG + Intergenic
1100817971 12:98404195-98404217 CTTTTCCTGCCTCCTCCCTGTGG - Intergenic
1102290517 12:111695492-111695514 ATGTTCATGTCTCCTCTATGGGG + Intronic
1102992723 12:117326746-117326768 TTGTCCCTCCCTCTTCCTTGGGG + Intronic
1103087811 12:118075293-118075315 GTGTTCCTGCCTTACCCATGAGG - Intronic
1103143698 12:118575215-118575237 AAGTCCCTTCCTCTTCCAGGAGG + Intergenic
1103262809 12:119603162-119603184 ATTTTCCTGCCTCTGCCTTTTGG - Intronic
1104285372 12:127419806-127419828 ATGCTTCTGCCATTTCCATGTGG + Intergenic
1106452835 13:29898865-29898887 ATGATGCTGCATCCTCCATGTGG - Intergenic
1108560979 13:51643710-51643732 CTGTTCCTGCTACTTCCTTGTGG + Intronic
1110509690 13:76334942-76334964 ATATTCTTGCCTCTCCCTTGGGG + Intergenic
1112712757 13:102149568-102149590 ACCTACCTGACTCTTCCATGAGG - Intronic
1113380677 13:109802741-109802763 ATGTTCCAGATTCTACCATGTGG + Intergenic
1113404918 13:110030141-110030163 ATGTTCCTGCATCTACCAGGTGG + Intergenic
1113547481 13:111165318-111165340 ATGTTCATGCCTGGCCCATGTGG + Intronic
1113693628 13:112329261-112329283 ATTTGCCTGCCTCCTCCAAGTGG + Intergenic
1113921688 13:113916956-113916978 AGGTTACTGCCTCTGACATGGGG + Intergenic
1114700643 14:24674430-24674452 ATGTACCTGCTTCTTCCATGGGG - Intergenic
1115147168 14:30239144-30239166 GTGTTCCTGATTCTTCCCTGGGG - Intergenic
1117105598 14:52394652-52394674 ATGTGCCTGCCCCTTCCTTTGGG + Intergenic
1120355833 14:83432387-83432409 ATGCTCTTGCCACTTCCCTGTGG - Intergenic
1121021425 14:90582488-90582510 ATTTTCCTGCCACATCCATCAGG + Intronic
1121120690 14:91374016-91374038 ATGTTCCAGCATCTGCCCTGGGG - Intronic
1121569495 14:94936809-94936831 AGGTTCCTGCCTATTCCCGGAGG - Intergenic
1122123273 14:99565856-99565878 ATCATCCTGCCTCTTCTCTGGGG - Intronic
1124111921 15:26798421-26798443 ATGTTTCTACCTTTCCCATGAGG + Intronic
1124119893 15:26880171-26880193 ATGTTCTTGTGTCTTCCCTGAGG + Intronic
1126142211 15:45448058-45448080 ATGTTCATGTCACTTCTATGAGG + Intronic
1127263017 15:57339447-57339469 TTGTTCCTGCTTTTGCCATGTGG + Intergenic
1128534225 15:68478651-68478673 AAGTTACTGCTTCTTCCAGGTGG - Intergenic
1129163657 15:73762582-73762604 TTTTTCATGCCTCTGCCATGGGG + Intergenic
1129603767 15:77014823-77014845 ATATTCCTGCCTCTGCCTTGAGG - Intronic
1132220718 15:100103101-100103123 ATGTTCCTGCCTCTTCCATGCGG - Intronic
1132229633 15:100171765-100171787 ATTTACCAGCCCCTTCCATGTGG - Intronic
1133681786 16:8126700-8126722 TTGTTCCTGCCTGTTTCCTGAGG + Intergenic
1134339475 16:13332172-13332194 TTGTCCCTGCCTCTTCCAACAGG - Intergenic
1134395434 16:13858213-13858235 ATGTTCATGCCTTTCCCTTGTGG - Intergenic
1134607542 16:15582903-15582925 ATGTCCCTGCCTCTGCCCTGGGG + Intronic
1135676557 16:24419982-24420004 AAGATCCACCCTCTTCCATGTGG + Intergenic
1135869134 16:26133098-26133120 GTTTTCCTGCCTTTTCCATTTGG + Intronic
1136285909 16:29241657-29241679 ATGTTCATGCCCCTTGCATCAGG - Intergenic
1137791397 16:51177589-51177611 CTGTTTCTGCCTCTTCCTTGTGG + Intergenic
1137961883 16:52889404-52889426 TAGATCCTGCTTCTTCCATGTGG + Intergenic
1139156404 16:64447977-64447999 ATGTTTCTTCCTCTTTCACGTGG - Intergenic
1139217468 16:65141961-65141983 ATGGGCCTGCCTCTTCAAAGGGG + Intergenic
1139675302 16:68519426-68519448 GTGGTCCTCCCCCTTCCATGTGG + Intergenic
1140269174 16:73447538-73447560 ATGTTCCTGCCTCTAGCAAGAGG - Intergenic
1141880599 16:86856534-86856556 CTGTTCTTGTCTCTTCCATGGGG - Intergenic
1143377658 17:6476936-6476958 ATGTCCCAGGCCCTTCCATGGGG - Intronic
1143836475 17:9696777-9696799 AAGGCCCTGCCTCTCCCATGTGG + Intronic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1146120065 17:30185058-30185080 CTGTTCATGCCTCTTCCAATGGG - Exonic
1146251270 17:31346196-31346218 ATCTTCCTGGTTCTTCCATTGGG - Intronic
1146363600 17:32200046-32200068 ATTCTCCTGCCTCAGCCATGAGG + Intronic
1147212996 17:38882983-38883005 ATGTTTCTGCCCCTTCCCTTAGG + Intronic
1150113146 17:62520011-62520033 GTGTTCCTGCTTCTTCCCTTAGG + Intronic
1150180123 17:63110573-63110595 TTGTTGCTGCATCTTCCAGGAGG + Intronic
1155166193 18:23234346-23234368 ACATCCCTCCCTCTTCCATGAGG - Intronic
1156609895 18:38713708-38713730 TGGTTACTGCCTCTTCCACGAGG + Intergenic
1158107894 18:53905787-53905809 ATGTTCCTGCCCTTTCGATCTGG - Intergenic
1161360919 19:3849236-3849258 AGGTTCCTGCTCCTTCCTTGGGG - Intronic
1165897830 19:39154012-39154034 ATGTTTTTGCCTCTTCTGTGTGG + Intronic
1166272240 19:41721612-41721634 CTGCTCCTGCCTCATCCAAGGGG - Intronic
1168004969 19:53479299-53479321 CGGTTCCTGCCTCCTCCATTCGG - Intronic
925759339 2:7169287-7169309 ATGTTGCTGCCTCTGCCAGGTGG - Intergenic
926269785 2:11356593-11356615 AAGTTCCTGCTTCTTTCCTGAGG - Intergenic
926272476 2:11377086-11377108 ATGTACCTGCCTCTCCCCAGAGG - Intergenic
926489486 2:13506408-13506430 TTGTTCCTGCATCATCCAAGGGG + Intergenic
927587919 2:24325601-24325623 ATTTTTCTGCCTCTTCGATAAGG - Intronic
927775596 2:25900468-25900490 ATGTTACTGACTCTTCAAGGTGG - Intergenic
927916681 2:26941629-26941651 AGGTTCCTGACTCATCCGTGTGG + Intronic
928687838 2:33767782-33767804 CTATGCCTCCCTCTTCCATGTGG + Intergenic
930344691 2:50165233-50165255 ATGTCCCTCACTCCTCCATGAGG - Intronic
932707780 2:74039954-74039976 ATGTTCCCTCCTCTTCAATCTGG - Intronic
936259742 2:110948580-110948602 CTGTTCCTGCTTGTTCCATGTGG + Intronic
937320241 2:120956620-120956642 AGGTGCCTGCCTGTTCCCTGTGG - Intronic
938324037 2:130385648-130385670 CTGTTCCTGGCTCTTACATGTGG - Intergenic
939363629 2:141205434-141205456 ATGTTCCACCCCATTCCATGTGG - Intronic
939955221 2:148522261-148522283 ATTTTCCTCCCTCTTCCCAGTGG + Intergenic
940092330 2:149934454-149934476 CTATTCCTTCCTCTTACATGTGG + Intergenic
942014232 2:171794975-171794997 ATGTTCCTGCCCCTTGGAAGCGG - Intronic
942053602 2:172162897-172162919 CTGCTCCTGCCTGCTCCATGGGG + Intergenic
942504956 2:176632105-176632127 ATGCTCCTGCACCTTTCATGTGG - Intergenic
944131706 2:196354092-196354114 ATGTTGCTTCCTGTTGCATGGGG - Intronic
944673800 2:202018137-202018159 ATGGTCCTGCCTGTTTCATCTGG - Intergenic
945321729 2:208432282-208432304 AAGTTTCTGCCTTTTCCCTGTGG + Intronic
946403798 2:219482550-219482572 AGTTTCCTGCCTCTCCCCTGGGG + Intronic
947638723 2:231694079-231694101 ATGTTCCTGTCTGTCCCATGAGG + Intergenic
948899673 2:240949928-240949950 CCCTTCCAGCCTCTTCCATGAGG - Intronic
1168979007 20:1989222-1989244 TGCTTCCTGCCTCTTCCATCAGG - Intronic
1169124822 20:3120015-3120037 GGCTTCCTGCCTCTTCCCTGGGG - Intronic
1169491802 20:6077343-6077365 CTGTGCCTTCCTCTTCCAGGTGG - Exonic
1169713275 20:8588580-8588602 ATGTTTCTTCCTCTTAGATGAGG - Intronic
1170575075 20:17656275-17656297 CTGTCTCTGCCTCTTCCTTGTGG + Intronic
1171392265 20:24809213-24809235 ATGCTCCTGCCTCTTTTATGGGG - Intergenic
1172228213 20:33319510-33319532 TTGTTGCTGCCTCTTCCAGTGGG + Intergenic
1172943272 20:38669159-38669181 ATGTGCCTGCCTCTAGTATGTGG - Intergenic
1173395100 20:42671919-42671941 AGATAACTGCCTCTTCCATGCGG - Intronic
1174073931 20:47918744-47918766 TTGTTCCTGCTTTTGCCATGTGG + Intergenic
1174399277 20:50267309-50267331 ATGTTCCTGGCTCTTCCTCTAGG + Intergenic
1175130890 20:56788817-56788839 ATGTCTCTGCCTCTTCCACAAGG + Intergenic
1175339007 20:58215747-58215769 ATCTTACTGGCTCTGCCATGTGG - Intergenic
1175356632 20:58374113-58374135 AAGTTCCTGCCTCTTGGATCTGG - Intergenic
1175576800 20:60066532-60066554 TTTTTCCTGTCTCTTCCACGAGG + Intronic
1177465163 21:21468480-21468502 ATGTTGCTGCTTCTTGGATGGGG + Intronic
1177763661 21:25432458-25432480 ATGTTTGTCCATCTTCCATGTGG - Intergenic
1178349446 21:31861963-31861985 ATGCCCCTTCCTCTTGCATGTGG - Intergenic
1179513302 21:41889341-41889363 TTGTGCCTCCCTCTTCCAGGAGG - Exonic
1180835601 22:18928089-18928111 ATGTGCCCCCCTCTTCCCTGTGG - Intronic
1182820096 22:33208261-33208283 ATCTTCCAGCCTGTTCTATGTGG - Intronic
1184022004 22:41827142-41827164 ATGTTCTGGGCCCTTCCATGAGG - Intergenic
1184251210 22:43261352-43261374 GTGTTCCTGGCTCTTTCCTGTGG - Intronic
1185190260 22:49431707-49431729 GTGTTACTTCCTCTTCCATTTGG + Intronic
1203285689 22_KI270734v1_random:153388-153410 ATGTGCCCCCCTCTTCCCTGTGG - Intergenic
951189443 3:19751119-19751141 ATGTTACTGCTTCTCCCAGGAGG - Intergenic
951594802 3:24306323-24306345 AGATTCCTGCCTCCTCCCTGTGG - Intronic
953232164 3:41074859-41074881 GTGCGCCTGGCTCTTCCATGTGG - Intergenic
955318261 3:57956728-57956750 CTGTTCCTGGCTGCTCCATGTGG - Intergenic
957681037 3:83435459-83435481 GTGTTCCTGCCTCTTCTAAGTGG + Intergenic
957898634 3:86457367-86457389 ATATTCCTGCATTTTCCATGTGG - Intergenic
958467273 3:94473315-94473337 ATTTTCCTGACTCCTTCATGGGG + Intergenic
959015274 3:101127053-101127075 ATCTTCCTACCTCTTCTGTGTGG + Intergenic
960571823 3:119191989-119192011 ATGTTGCTGAGTCATCCATGTGG - Intronic
963510624 3:146243146-146243168 TTCATCCTGCTTCTTCCATGGGG + Intronic
964475069 3:157090703-157090725 ATGTTCCTAACTCTTCCTGGAGG - Intergenic
965572057 3:170182471-170182493 CTGTTCCTGCTTGTTCCTTGTGG - Intergenic
966299044 3:178458417-178458439 ATGTTCTTGGCTCCTCCACGAGG + Intronic
966403420 3:179570048-179570070 ATGTTTCTGACTCTTACAGGTGG + Exonic
966711043 3:182973087-182973109 ACGTTCCTCCCTCCCCCATGTGG - Intronic
966712702 3:182985878-182985900 AAGTCCATGCCTCTACCATGAGG - Intronic
966928128 3:184658757-184658779 AGGTTCCTTCCTCTTCCAACTGG - Intronic
967299536 3:187999107-187999129 ATGTCTCTGCATCTCCCATGGGG - Intergenic
967725337 3:192857333-192857355 ATGAACCTGCCAATTCCATGTGG + Intronic
967826695 3:193882822-193882844 CTTTGCCTGCCTCTGCCATGGGG - Intergenic
968380008 4:85472-85494 ACTTTCCTTCCTGTTCCATGTGG + Intronic
968879003 4:3288997-3289019 ATCTACCTGCCTCTGCCATCAGG + Intergenic
971119175 4:23684995-23685017 CTGTCCCTGCCTCTTCATTGTGG + Intergenic
972232605 4:37093125-37093147 GTGTCCATGCCTCTTCCCTGTGG + Intergenic
975588602 4:75977605-75977627 ATTTCCCTGCATCTTCCTTGAGG - Intronic
977925149 4:102692230-102692252 CTGTTCCTGGCTTTTCCAAGTGG - Intronic
980475615 4:133310475-133310497 TTGTTCCTGCCCTTTCCGTGTGG + Intergenic
980665243 4:135925080-135925102 ATCTTCCTGGCTATTCCCTGGGG + Intergenic
981666669 4:147234985-147235007 ATGTAGTTGCCTCTTCCAGGTGG - Intergenic
981908633 4:149952959-149952981 TTGTTCCTGCCTGTTTCAGGTGG + Intergenic
982470395 4:155782623-155782645 ATGATTTTGCCTCTTCCTTGCGG + Intronic
983207776 4:164929588-164929610 ATCTTCCTGCCTTTTCCTGGTGG + Intergenic
984886895 4:184457217-184457239 ATTTTCCTGGATCATCCATGTGG + Intronic
984922494 4:184778089-184778111 ATCTTACTGCATCTTGCATGTGG - Intronic
985142495 4:186856771-186856793 TTGCTCCTGCTTCCTCCATGAGG + Intergenic
985262281 4:188126219-188126241 ACTTTTCTGACTCTTCCATGAGG + Intergenic
986436933 5:7743366-7743388 ATGTTCCTGGCAGTTTCATGTGG - Intronic
990412123 5:55551857-55551879 ATCTTCCTGGTTCTTCCATTGGG + Intergenic
990499156 5:56377916-56377938 ATGTTCCTGGAGCTTCTATGTGG - Intergenic
991768724 5:70018726-70018748 ATCTTCCATCCTCTTCTATGGGG + Intergenic
991847962 5:70893803-70893825 ATCTTCCATCCTCTTCTATGGGG + Intergenic
992640491 5:78764521-78764543 TTTTTCCTTCCTTTTCCATGGGG - Intronic
992662390 5:78974463-78974485 ATTTTCCTTCCTTTTCCATTTGG - Intronic
993124578 5:83817671-83817693 ATGTTACTGCCTATTCTATAGGG - Intergenic
993626568 5:90232113-90232135 AATTACCTGCCTCTCCCATGAGG - Intergenic
996157566 5:120120612-120120634 ATGTGCCTCTATCTTCCATGAGG - Intergenic
996211548 5:120817518-120817540 ATGTTCCTGCCTCTAGGATGTGG - Intergenic
996544388 5:124662406-124662428 ATGTTCCTGCCTCTTCTGAGAGG - Intronic
996868355 5:128156145-128156167 CTGTTCCTGCCACTTCCAGAGGG + Intronic
1000996382 5:167963029-167963051 ATGTACCTGCCTCCTCCTTTAGG - Intronic
1001251241 5:170148661-170148683 ATGATGCTCCCTCTTTCATGAGG - Intergenic
1004591698 6:17058128-17058150 CTCTTCTTGCCTCTTCCAGGTGG + Intergenic
1005606428 6:27482516-27482538 ATGTTCATGCCTCTCCCAGTTGG + Intergenic
1006303552 6:33206619-33206641 ATGTTTCTGCCCCTCCCAGGAGG + Exonic
1007493071 6:42239566-42239588 ATGTTCCTTCATGTTCCATCTGG + Intronic
1008064609 6:47034105-47034127 ATGTTTGTACCTCTTCCGTGAGG + Intronic
1008100147 6:47381211-47381233 ATGTTTCTGCCTTTTCCCTTTGG - Intergenic
1008482382 6:51999291-51999313 ATGCTCCTGCCTCTCCCTTCTGG + Intronic
1010663189 6:78595672-78595694 ATGTTCCTTCCTCTTGAATCTGG + Intergenic
1011908683 6:92407497-92407519 ATTTTACTACCTCTTCCATTTGG + Intergenic
1012201078 6:96406757-96406779 ATGTTTCTGTATCTTCCAGGTGG - Intergenic
1013451227 6:110283287-110283309 ATGTCCCTGCCTTTTCTTTGGGG - Intronic
1013691797 6:112653417-112653439 AAGTTCCTTCCTCTTTCTTGGGG + Intergenic
1013893205 6:115051141-115051163 CTGTTTCTGCATCTTCCAAGGGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015420033 6:132997023-132997045 ATGTTCCTGGGTTTTCCAGGTGG + Intergenic
1016725830 6:147366101-147366123 TTGTTCCTGCCTCTTCAACTTGG - Intronic
1018081606 6:160263644-160263666 TTTCTCCTTCCTCTTCCATGAGG + Intronic
1018463582 6:164022034-164022056 TGGTTCCTGCCTCTGCCAGGAGG + Intergenic
1018562354 6:165115011-165115033 ATGTTGCTGCCTCTGGTATGAGG - Intergenic
1018648819 6:165973646-165973668 ATCTGTCTGCCTCTTCCCTGGGG - Intronic
1019335214 7:479554-479576 ATGTGTTTGCCTCTCCCATGAGG - Intergenic
1019854965 7:3596212-3596234 ATCTTGCTGGCTCTTCCATCTGG + Intronic
1020332976 7:7039115-7039137 GTCTTTCTGCTTCTTCCATGAGG - Intergenic
1021536467 7:21710440-21710462 ATTTTGCTGCCTCTTTCTTGCGG - Intronic
1022084497 7:27053360-27053382 ATGTTCGTGCCCTTTGCATGGGG - Intergenic
1023154686 7:37236959-37236981 ATGTTCCTGGATGTGCCATGTGG - Intronic
1023819429 7:43972425-43972447 TTGTTACTGCCTCTTCCCTAGGG - Intergenic
1026402526 7:70029301-70029323 ATGTTTCTGTCTCTGCGATGTGG + Intronic
1029744480 7:102509394-102509416 TTGTTACTGCCTCTTCCCTAGGG - Intronic
1029762471 7:102608556-102608578 TTGTTACTGCCTCTTCCCTAGGG - Intronic
1030342718 7:108398799-108398821 ATGTGCCTGTCTCTTGCATTTGG + Intronic
1030414465 7:109224432-109224454 GTGTTCCTTCCTCATCCATTTGG + Intergenic
1031041526 7:116843354-116843376 CTGTTCCTGCCTCTTGGATTTGG + Intronic
1031139781 7:117929693-117929715 TTCTTCCTGTCCCTTCCATGTGG + Intergenic
1031919539 7:127590711-127590733 ACATTCCTGCCTTTTCCATTTGG + Intronic
1032042359 7:128573948-128573970 GTGTTCCTGCTTCTTCCCTTAGG + Intergenic
1034166840 7:149031428-149031450 ATGTTCCGCCTTCTACCATGTGG + Intergenic
1035335103 7:158122910-158122932 TTGTTACTGCCTCTTCCTTGTGG + Intronic
1036495636 8:9267691-9267713 ATGTGCCTGCCACTTCTAAGTGG + Intergenic
1036649968 8:10635940-10635962 CTGTGCCAGTCTCTTCCATGGGG - Intronic
1037129039 8:15385474-15385496 GTGTTCATGCCTCTTCCAGGTGG - Intergenic
1037673174 8:21032830-21032852 GTGTTCCTGCCTCTGCTATTGGG + Intergenic
1037812836 8:22097075-22097097 ATGGTCCTGCCTCTCCCACTAGG - Intronic
1038182899 8:25245475-25245497 ATTTTTCTAACTCTTCCATGTGG + Intronic
1038876022 8:31550415-31550437 ATGTTCCCTCCTCAGCCATGGGG + Intergenic
1040846570 8:51848236-51848258 ATGTTCCTGCCACTACAATCCGG + Intronic
1041000175 8:53441943-53441965 TTCTTCCTGCCTCTTCTCTGAGG - Intergenic
1041006122 8:53498306-53498328 CTGCTCCTGGCTCTTGCATGGGG + Intergenic
1041018675 8:53616509-53616531 GTGTTCCTGCCTCTTCTCAGTGG - Intergenic
1042421873 8:68601149-68601171 CTGTTTCTTCCTCTTTCATGTGG + Intronic
1043584984 8:81758471-81758493 ATGTTCCAGCATCTTCCCAGAGG + Exonic
1043706363 8:83356031-83356053 ATGTTTCTGTATCTTCCATGTGG + Intergenic
1045939256 8:107718771-107718793 ATTATTCTGCCTCTTCCATTTGG - Intergenic
1046712727 8:117529734-117529756 ATGTTCCTATCTCTTCTATTTGG - Intronic
1046905919 8:119573051-119573073 TTCTTCATGTCTCTTCCATGAGG - Intronic
1049427918 8:142545516-142545538 CTGCTCCTGCCTCTGCCCTGGGG + Intergenic
1051225748 9:14897372-14897394 ATGTTCCTTGCTCTACCATAGGG + Intronic
1053576179 9:39358592-39358614 ATGTTTCTGCCTCCTCCCGGTGG + Exonic
1053840696 9:42186529-42186551 ATGTTTCTGCCTCCTCCCGGTGG + Exonic
1054097751 9:60917283-60917305 ATGTTTCTGCCTCCTCCCGGTGG + Intergenic
1054119153 9:61192913-61192935 ATGTTTCTGCCTCCTCCCGGTGG + Exonic
1054588600 9:66989649-66989671 ATGTTTCTGCCTCCTCCCGGTGG - Intergenic
1055977148 9:81966651-81966673 CCCTTCCTGTCTCTTCCATGAGG + Intergenic
1057298831 9:93864915-93864937 CTGTTCTTGCCACCTCCATGTGG - Intergenic
1058977258 9:110136606-110136628 TTCTTTCTGCCTCTGCCATGGGG - Exonic
1059127916 9:111711385-111711407 AAGTTCCTGCCACTTGCAGGAGG + Intronic
1059563574 9:115359589-115359611 AGGTTCCTGCCTCCTCTTTGGGG + Intronic
1059667963 9:116467017-116467039 ATGTTCCTGCCTCTCACCAGAGG + Intronic
1060506596 9:124202564-124202586 CTGTTCCTGCCTCCTCGCTGTGG - Intergenic
1060823400 9:126674028-126674050 TGCTTCCTGCCTCATCCATGGGG + Intronic
1061376390 9:130227276-130227298 TTTTTCCTGCCTCTTCTTTGTGG + Intronic
1061444450 9:130630063-130630085 AAGTCCCTGCCTCCTCCATGGGG - Intronic
1186645266 X:11500232-11500254 ATCTACCTGCTTCATCCATGGGG + Intronic
1187000075 X:15167628-15167650 ATGTTCCTTCTTATTCTATGTGG + Intergenic
1189130622 X:38494361-38494383 GTGTTCTTGCCCCTTCCTTGGGG + Intronic
1189856997 X:45233535-45233557 TTGTTCCTGTTTCTACCATGTGG + Intergenic
1191722507 X:64245842-64245864 ATGTTTCTACCTTTTTCATGTGG + Intergenic
1192925068 X:75747420-75747442 ATGTGCCTGGCACTTCCATGAGG - Intergenic
1197769627 X:130081944-130081966 ATGCTGCTGCCTCGTCCACGAGG - Intronic
1197920593 X:131589562-131589584 TTGGCCCTGCCACTTCCATGTGG - Intergenic
1200122171 X:153796301-153796323 CTCTTCCTGCCCCTTCCAGGTGG - Intronic