ID: 1132221536

View in Genome Browser
Species Human (GRCh38)
Location 15:100108999-100109021
Sequence GAGACTGATCTCTGCGTGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132221536_1132221540 -8 Left 1132221536 15:100108999-100109021 CCGTGCACGCAGAGATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1132221540 15:100109014-100109036 TCAGTCTCGTAGGGCCCGCAGGG 0: 1
1: 0
2: 0
3: 0
4: 33
1132221536_1132221551 30 Left 1132221536 15:100108999-100109021 CCGTGCACGCAGAGATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1132221551 15:100109052-100109074 CCTGTCGGCCACCAGCAGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 203
1132221536_1132221544 15 Left 1132221536 15:100108999-100109021 CCGTGCACGCAGAGATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1132221544 15:100109037-100109059 TGTACCGTCCAGGACCCTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 53
1132221536_1132221547 28 Left 1132221536 15:100108999-100109021 CCGTGCACGCAGAGATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1132221547 15:100109050-100109072 ACCCTGTCGGCCACCAGCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 155
1132221536_1132221541 5 Left 1132221536 15:100108999-100109021 CCGTGCACGCAGAGATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1132221541 15:100109027-100109049 GCCCGCAGGGTGTACCGTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 36
1132221536_1132221549 29 Left 1132221536 15:100108999-100109021 CCGTGCACGCAGAGATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1132221549 15:100109051-100109073 CCCTGTCGGCCACCAGCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 131
1132221536_1132221539 -9 Left 1132221536 15:100108999-100109021 CCGTGCACGCAGAGATCAGTCTC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1132221539 15:100109013-100109035 ATCAGTCTCGTAGGGCCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132221536 Original CRISPR GAGACTGATCTCTGCGTGCA CGG (reversed) Exonic