ID: 1132221840

View in Genome Browser
Species Human (GRCh38)
Location 15:100110945-100110967
Sequence CTGGTGAGAAGCAGACTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132221840_1132221846 23 Left 1132221840 15:100110945-100110967 CCACGAAGTCTGCTTCTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1132221846 15:100110991-100111013 CAGCGCTGGAAAGAAGCTCCAGG 0: 1
1: 0
2: 2
3: 16
4: 192
1132221840_1132221845 9 Left 1132221840 15:100110945-100110967 CCACGAAGTCTGCTTCTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1132221845 15:100110977-100110999 GAAATCTTGTCTTACAGCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132221840 Original CRISPR CTGGTGAGAAGCAGACTTCG TGG (reversed) Intronic
900440492 1:2652648-2652670 CAGGTGAGAACCTGACATCGTGG + Intronic
901090303 1:6636349-6636371 CTGGGGAGATGCAAACTTTGGGG + Intronic
901877225 1:12173777-12173799 CTGCTGAGTAGCTGACTGCGGGG + Intronic
902329538 1:15724575-15724597 CTGGGGAGAAGCAGCCTGGGGGG + Intronic
906689026 1:47780605-47780627 CTGGGGTCAAGCAGACTTCCTGG + Intronic
909931348 1:81503084-81503106 CTGCTGAGAAGAAGGCGTCGAGG + Intronic
910095594 1:83518108-83518130 CTGGAAAGAAGCAGGCTTTGGGG + Intergenic
910252667 1:85214144-85214166 TTGGTGAGAATCAGACTAAGAGG - Intergenic
911614774 1:99997812-99997834 CTGGTGATAAACAGGCTTCTAGG - Intronic
912248174 1:107983053-107983075 CTGATGAGAAGTAGACAGCGTGG - Intergenic
912958930 1:114177768-114177790 CTGGTGAGAATCAGGAGTCGTGG + Intergenic
913385044 1:118250410-118250432 CTGGAGAGAAGCACAGTTTGAGG + Intergenic
922468167 1:225859137-225859159 CTGGTGAGAAGAGGGCTTGGTGG - Intronic
1066451212 10:35532076-35532098 CTGGAGAGGAGCAGCCTTGGAGG + Intronic
1070529606 10:77325281-77325303 CTGGTGAAGGGCAGACTTCCAGG - Intronic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1073353225 10:102834446-102834468 CAGGTGAGAAGCAGGCTTAGCGG - Intronic
1073599072 10:104829262-104829284 CTGGTGAGTAGCAAAATTGGAGG + Intronic
1074545566 10:114399724-114399746 CTGGAGAGTAGCAGACTTAGTGG - Intronic
1075276609 10:121099329-121099351 GAGGTGAGGAGCAGACTTCTTGG + Intergenic
1078898262 11:15617249-15617271 CTGATCAGAAACAGACTTCTAGG + Intergenic
1080827368 11:35859589-35859611 ATTGAGAGAAGCAGACTTGGAGG + Intergenic
1081296809 11:41400528-41400550 ATGGGGAGAAGAAGACTTCAGGG + Intronic
1081495153 11:43601819-43601841 CTGGTGAGAAGCAAACTGAGAGG - Intronic
1083629675 11:64089137-64089159 CTGGTGACCAGCAGCCTTCCAGG + Intronic
1084197320 11:67530773-67530795 CTGGTGAGACGCAGCCCTCTGGG + Intergenic
1084944495 11:72631435-72631457 CTGGAGAGAAGCAGAAGTGGAGG - Intronic
1085391832 11:76186071-76186093 CAGCTGGGATGCAGACTTCGGGG - Intergenic
1089655569 11:119944458-119944480 CAGGTGAGAAGCAGACCTGGGGG + Intergenic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1096860836 12:54526927-54526949 AGGGTGAGAAGGAAACTTCGTGG - Intronic
1097647163 12:62250078-62250100 CTGGTGAGAAGCACTCATGGTGG + Intronic
1098092400 12:66918104-66918126 TTGGTGAGCTGCAGACTTAGAGG + Intergenic
1102381815 12:112473543-112473565 CTGCTCAGAAGAAGACTTTGTGG + Intronic
1104726722 12:131082257-131082279 CTGTTTAGATGCAGACTTCCTGG + Intronic
1105518916 13:21114184-21114206 CTGGTGTGATGAAGCCTTCGAGG + Intergenic
1105701329 13:22937646-22937668 CTGGTGAGAAGCAGGCGTGAGGG - Intergenic
1108536867 13:51391918-51391940 CTGGGGAGAAGCAGGTTTAGGGG - Intronic
1109255209 13:60071948-60071970 CTGATGGGAAGCAGAATTGGGGG - Intronic
1110178645 13:72588516-72588538 TTGGTGTGAAGGAGACTTCAAGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1118896488 14:69949792-69949814 CTGGTGAGAATCAGACCCGGGGG - Intronic
1120877084 14:89384990-89385012 CTGGTAAGATGCCGACTTAGGGG - Intronic
1121898116 14:97667717-97667739 CTGGGGAGAAGCAGAGGTTGGGG + Intergenic
1122722498 14:103730188-103730210 CTGGGGAGCAGCAGGCCTCGGGG - Intronic
1126129352 15:45325545-45325567 CTGGAGAGAAGGAGAATTTGAGG - Intergenic
1129294342 15:74591692-74591714 CTGCTGAGAAGAAGGCATCGAGG + Exonic
1132221840 15:100110945-100110967 CTGGTGAGAAGCAGACTTCGTGG - Intronic
1133596379 16:7297362-7297384 CTGCTGAGAAACAGACTGCCAGG - Intronic
1133712956 16:8419307-8419329 CTGGTGAGCAGCAGACTAACAGG - Intergenic
1134132459 16:11659034-11659056 CTGGTGAGAAGGAGCCTGCAAGG + Intergenic
1134352632 16:13452047-13452069 CTGGTGACATGCAGAATTAGAGG - Intergenic
1134772017 16:16817285-16817307 CTGCTGAAAAGCAGACTTAGTGG + Intergenic
1136281430 16:29213706-29213728 CTGGTAAAAGGCAGACTTCCAGG - Intergenic
1138668330 16:58592251-58592273 CTGGTGAGGAGCAGACAGCATGG + Intronic
1140127999 16:72133798-72133820 CTGGTGATCAGCAGACTCCTGGG + Intronic
1141327287 16:83073244-83073266 CTAGTAAGAAACAGAGTTCGAGG + Intronic
1142085800 16:88179634-88179656 CTGGTAAAAGGCAGACTTCCAGG - Intergenic
1142826025 17:2511648-2511670 CTAGTGAGGTGCCGACTTCGGGG - Intronic
1143297322 17:5881060-5881082 CTGGAGAGGAGCAGACTAAGGGG - Intronic
1143595585 17:7911803-7911825 CTGGTGAGAAGAAGTCTGGGTGG + Exonic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1149344312 17:55718820-55718842 CTGATGAGAAGCAGGATTTGGGG + Intergenic
1151822971 17:76507012-76507034 CTGGTGAGGAGCAGCCTGCTGGG - Intergenic
1151937909 17:77274567-77274589 CTGGTGAGGAGGAGACTCCTGGG + Intergenic
1152160915 17:78668150-78668172 CTGGTGAGTAGCAGAGTTGATGG - Intergenic
1153770159 18:8408781-8408803 CTGCTGTGAAGCTGACTTAGAGG - Intergenic
1156764931 18:40641292-40641314 CTGGTGCAAAACAGACTTCCAGG + Intergenic
1157404091 18:47409115-47409137 CTGGTCAGAAGCAGTGCTCGGGG - Intergenic
1157446375 18:47749437-47749459 CTGGGGAGAAGCAGAGGGCGGGG - Intergenic
1163859631 19:19735073-19735095 ATGCTCAGAAGCAGACTTCCTGG + Intergenic
1164441284 19:28282444-28282466 CTGTGGAGAAGAAGACATCGTGG - Intergenic
1165250740 19:34531819-34531841 CTGGTTAGAAACAGAACTCGAGG - Intergenic
1165876040 19:39007578-39007600 CTGGGGAGATGCAGAGTTGGGGG - Intronic
1168645187 19:58055009-58055031 CGGGTGAGAAGCCGAGTCCGAGG - Intergenic
926109767 2:10174300-10174322 TTGGGGAGAAGCAGAATTTGAGG + Intronic
926113480 2:10196860-10196882 CTGATGGGAAGGAGACTGCGTGG + Intronic
926501926 2:13666401-13666423 TTATTGAGAAGCAGACTTCGTGG + Intergenic
926704203 2:15825362-15825384 CTGGTGGGAAGGAGATTTCTCGG + Intergenic
929167029 2:38892933-38892955 CTGGTAAGAAGATGACTTAGTGG - Intronic
929593648 2:43162400-43162422 CTGGTGAGAACCTGAGGTCGTGG - Intergenic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
931591187 2:63885123-63885145 GTGGTGGGAAGCAGACATCTTGG + Intronic
932323145 2:70836572-70836594 CTGGTGAGGAGCAGACTGGTGGG + Intergenic
933763613 2:85692683-85692705 CTGGTGAGAAGTTGAGTTTGAGG - Intronic
940769424 2:157824640-157824662 CTGGTGAGAAGTTGACTTAAGGG - Intronic
942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG + Intergenic
942512301 2:176715420-176715442 CTGGTTAGAATCAGAGTTCCTGG + Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
948888758 2:240896838-240896860 CTGGAGAAAAGCAGTCTCCGTGG + Intronic
1169332731 20:4729563-4729585 CTGTTGAGGAACAGACTTCTTGG + Intergenic
1169905455 20:10598750-10598772 CTGGTAAGAAGCCGATTTCTTGG + Exonic
1170690816 20:18613693-18613715 CTGGTGTGATGCATACTTTGAGG + Intronic
1173598689 20:44277475-44277497 CGGGAGAGAAGCAGACTCTGAGG + Intronic
1174566816 20:51470595-51470617 TTGGTGAGAAAAACACTTCGTGG - Intronic
1178684951 21:34703371-34703393 CTGGTGAGAAGGAGAGTGTGGGG + Intronic
950133498 3:10564057-10564079 CTGGTGAGAAAGAAACTTCAGGG + Intronic
951229039 3:20155391-20155413 ATGGTGAGAGGGAGACTTTGAGG + Intergenic
951403339 3:22262852-22262874 CTGGGGAGAAGCAGGCTAGGTGG - Intronic
953259780 3:41326543-41326565 CAGGTGAAAGGCAGACTTCAGGG + Intronic
954878628 3:53819482-53819504 CTGGTGGGAAGGAGACATCCTGG + Intronic
960255761 3:115509767-115509789 CTGGTGAGAAAGAGAGTTAGGGG + Intergenic
961010010 3:123429453-123429475 CTGAGGAGAGGCAGACTTTGTGG - Intronic
963419172 3:145037786-145037808 CCGGTGAAAAGCAGACTTTCAGG - Intergenic
964329220 3:155582796-155582818 TTAGTGAGAAACAGACTTTGAGG + Intronic
968645357 4:1737905-1737927 CTGGTGGGCAGCTGACTGCGGGG - Intronic
977347492 4:95835807-95835829 CTTGAGAGAAACAGACTTTGAGG - Intergenic
981816403 4:148835522-148835544 CAGATGAGAACCAGACTTCAGGG - Intergenic
986919674 5:12666583-12666605 CTGGCGAGAAGCAGCCTGGGAGG + Intergenic
988800092 5:34688628-34688650 ATGTTGAGAAGCAGACCTGGGGG + Intronic
992654077 5:78891025-78891047 CTCTTGAGAAGCAGAGTTCATGG - Intronic
992839185 5:80670475-80670497 TTGGTGGGAACCAGACTTGGTGG + Intronic
998648890 5:144095079-144095101 ATAGTGAAAAGTAGACTTCGAGG + Intergenic
1008247965 6:49202561-49202583 TTGGTGAGGAGCAGAATTCTAGG + Intergenic
1013173533 6:107658438-107658460 CTGGGGAGAAGCAGAGATGGTGG - Exonic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1015087316 6:129310962-129310984 CTACTGAGAAGCCGACTTCAAGG + Intronic
1018689324 6:166332255-166332277 CTTGTGATAAGCAGACGTCAGGG - Intronic
1018968561 6:168508545-168508567 CAGCTGAGATGCAGACTTCAAGG + Intronic
1022119175 7:27290662-27290684 ATGGTAAGAAGCAGATTTGGTGG + Intergenic
1022346340 7:29518155-29518177 AGGGTGAGAAGCAGCCTTGGAGG - Intergenic
1022556803 7:31306293-31306315 ATGGTGAGAATCAAATTTCGAGG + Intergenic
1023930501 7:44702477-44702499 CTGGTGGGATGCAGGCTTCCTGG - Intronic
1026257682 7:68726667-68726689 CAGGGGAGATGGAGACTTCGGGG - Intergenic
1028476981 7:91264398-91264420 CTGGTGAAAGACAGACTACGGGG + Exonic
1028498024 7:91484143-91484165 CTAGTGAGAAACAGGCTGCGGGG - Intergenic
1029414071 7:100431985-100432007 CTAGTGAGCAGCAGCCTTCAAGG - Intronic
1032248930 7:130236317-130236339 CAGGTGAGGAGCAGCCTTCCAGG + Intergenic
1033140875 7:138825295-138825317 CTGGGGAGAGGCAGAGTGCGAGG - Intronic
1033979045 7:147140920-147140942 CTGGCGAGAATGAGACTCCGGGG + Intronic
1035175188 7:157045325-157045347 CTGGTGAGGGGCAGACACCGTGG - Intergenic
1038458439 8:27694613-27694635 CGGTTGAGAAGCAGAATTAGGGG + Intergenic
1043728388 8:83643012-83643034 ATGGTGAGAAGCAGAGATCTGGG - Intergenic
1044466973 8:92518508-92518530 CTGGGTAGAAGCAGGCTGCGGGG + Intergenic
1048007806 8:130432990-130433012 CTGTTGAGCAGCATACTGCGGGG - Intronic
1048887195 8:138918034-138918056 CTGGAGAGGAGCAGGCTCCGTGG + Intergenic
1049621776 8:143601504-143601526 CTGAGGAGAAGCTGACTTCACGG + Exonic
1050419397 9:5447569-5447591 CTCGTGTCAAACAGACTTCGTGG - Intergenic
1052819665 9:33128817-33128839 CTGGGGAGAAGCAGACTCCTGGG - Intronic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1055889685 9:81109448-81109470 CTGGTGAAATGCAGACTTTAGGG + Intergenic
1056265649 9:84894117-84894139 CTGGTGAGACCCACACTTGGGGG + Intronic
1057821098 9:98331690-98331712 CTGTTATGAAGAAGACTTCGTGG - Intronic
1060827327 9:126694623-126694645 CTGGTGAGAGGGAGGCTTCTGGG + Intronic
1061183337 9:129037581-129037603 CTGGAGTGAAGCAGGCTTGGGGG + Intronic
1062088128 9:134659041-134659063 CAGGTGAGAAGCAGGCTCAGAGG + Intronic
1191682121 X:63851726-63851748 TTGGAGAAAAGGAGACTTCGAGG - Intergenic
1198746838 X:139899783-139899805 GTGGTTAGAAGCAGAGTTTGGGG - Intronic