ID: 1132223385

View in Genome Browser
Species Human (GRCh38)
Location 15:100122244-100122266
Sequence TATTAGCTATAACAGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132223385_1132223391 17 Left 1132223385 15:100122244-100122266 CCAACCACCTGTTATAGCTAATA 0: 1
1: 0
2: 0
3: 25
4: 209
Right 1132223391 15:100122284-100122306 TGATTTAAAAATATGACCACAGG 0: 1
1: 0
2: 5
3: 38
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132223385 Original CRISPR TATTAGCTATAACAGGTGGT TGG (reversed) Intronic
902177436 1:14661552-14661574 TATTTACAAGAACAGGTGGTGGG + Intronic
904949802 1:34227550-34227572 TATTAATTAGAACAGGTGGATGG + Intergenic
905935409 1:41820042-41820064 TATTGACAAAAACAGGTGGTGGG + Intronic
906155303 1:43610565-43610587 TATTTACAAAAACAGGTGGTGGG - Intronic
907152172 1:52299294-52299316 CATTAGCTCTAACAGGTTTTTGG + Intronic
907382941 1:54106071-54106093 TATTTACAAAAACAGGTGGTGGG + Intronic
907760878 1:57358026-57358048 TATTAGCTCTAACAGTTTTTTGG + Intronic
908455000 1:64295003-64295025 TATTTACAAAAACAGGTGGTGGG + Intergenic
908872844 1:68634432-68634454 TATTTGCAAAAACAGGTGGTGGG + Intergenic
909385730 1:75053975-75053997 TATTAGCTATAACTGGGGATTGG - Intergenic
911661300 1:100504552-100504574 TATTAACAAAAATAGGTGGTGGG + Intronic
913358034 1:117945529-117945551 TATTTGGTATATCAGGTGTTAGG - Intronic
914005991 1:143732749-143732771 GATTAGCTATCAAAGGTGGTTGG + Intergenic
914098462 1:144563983-144564005 GATTAGCTATCAAAGGTGGTTGG + Intergenic
914229028 1:145747790-145747812 TATTTACAATAACAGGTGGCAGG + Intronic
914300522 1:146373659-146373681 GATTAGCTATCAAAGGTGGTTGG - Intergenic
914518165 1:148391773-148391795 GATTAACTATCAAAGGTGGTTGG + Intergenic
915761045 1:158313457-158313479 TATTAGCCAAAAATGGTGGTGGG - Intergenic
916278092 1:163016825-163016847 TATTAGTTATAACAGCTTTTTGG + Intergenic
917578873 1:176353417-176353439 TATTAGTTATAACAGCTTTTTGG + Intergenic
918549618 1:185727167-185727189 TATTAGCTATTACATCTGATAGG + Intergenic
918789082 1:188802279-188802301 TATTAGCTATAACTGTTTGTTGG - Intergenic
919254755 1:195106386-195106408 TGTTAGGTATATCATGTGGTGGG + Intergenic
919267253 1:195285936-195285958 TATTAACTATAAAAGGAGATTGG + Intergenic
919795983 1:201321898-201321920 TATTAGCTAGGGTAGGTGGTAGG + Intronic
919871673 1:201826671-201826693 CATTAGATATAAAAGGGGGTAGG - Exonic
922420112 1:225454167-225454189 TATTTGTTATAACAGGTGCCAGG + Intergenic
923171288 1:231420410-231420432 TAAGAGCTATAACAGGGGGAGGG + Intronic
924449495 1:244164734-244164756 CATTAGCAAGAACAGGTGTTTGG - Intergenic
1063778627 10:9294215-9294237 AATTTGCAAAAACAGGTGGTTGG + Intergenic
1064117705 10:12593172-12593194 TATTTACAAAAACAGGTGGTGGG + Intronic
1064343041 10:14504011-14504033 TATTAGCTGTAACAGTTTTTTGG + Intergenic
1065616526 10:27531652-27531674 TATTTAATAAAACAGGTGGTGGG + Intronic
1066257933 10:33699239-33699261 TTTTAACTAAAACAGGTGGCAGG + Intergenic
1071599554 10:86951608-86951630 TGTTAGCAAAAACAGGTGATGGG + Intronic
1072409797 10:95191031-95191053 TATTAGTTCTAACAGGTTTTTGG - Intergenic
1072667834 10:97407342-97407364 TTTTAGCCCTAACAGGTTGTTGG - Intronic
1073904440 10:108261603-108261625 TATCATCTATAGCAGGTGCTTGG - Intergenic
1074462441 10:113650634-113650656 TATGAGCTATGACAGGAGATGGG - Intronic
1074625082 10:115174725-115174747 TATTTACAAAAACAGGTGGTGGG + Intronic
1075658936 10:124180079-124180101 TATTATATATAACGGATGGTTGG - Intergenic
1078703767 11:13717808-13717830 TATTTACAAAAACAGGTGGTGGG + Intronic
1079231228 11:18650587-18650609 TATTAACTATAACAGAAGATTGG + Intergenic
1081828410 11:46081766-46081788 TATTTGCAAAAACAGGTGGTGGG - Intronic
1085148495 11:74226812-74226834 TATTCACTATAACAGGGGATTGG + Intronic
1087462237 11:98459737-98459759 TATTAGACATAACATGTAGTAGG + Intergenic
1087970540 11:104476075-104476097 TATTAGCTGTATCAGTTGATGGG + Intergenic
1088162558 11:106890285-106890307 AATTAGCTAGAACAGGTTGCTGG - Intronic
1089172347 11:116521866-116521888 TATAAGCTAAAAGTGGTGGTGGG + Intergenic
1089888385 11:121854336-121854358 TATTTTCTATTACAGTTGGTTGG - Intergenic
1093250313 12:16794676-16794698 TATTTACGAAAACAGGTGGTGGG - Intergenic
1094112095 12:26872825-26872847 TAATATGTATAATAGGTGGTTGG - Intergenic
1096025223 12:48354952-48354974 TATTTGCTATATCAGGTGATAGG + Intergenic
1097912593 12:64986520-64986542 TAGTAGCTATAACAGCTGTAGGG + Intergenic
1097950567 12:65422920-65422942 TATTAGTTTTAACAGGTTTTTGG + Intronic
1098413768 12:70209777-70209799 TATTAGCTGTAACAGTTCTTTGG + Intergenic
1098924082 12:76329787-76329809 TATTAGCAATAATAGGTGGCAGG - Intergenic
1099143384 12:79008376-79008398 TATAAGCCATGACAAGTGGTCGG + Intronic
1099648354 12:85390541-85390563 TATTTGCAAAAACAGATGGTGGG + Intergenic
1099680819 12:85825467-85825489 TATTTACAAAAACAGGTGGTGGG - Intronic
1101936873 12:109065328-109065350 TATTGACAAAAACAGGTGGTGGG - Intronic
1102872133 12:116422318-116422340 TATTAACAAAAACAAGTGGTGGG + Intergenic
1103045171 12:117730147-117730169 TATTTACAAAAACAGGTGGTGGG + Intronic
1103490514 12:121315090-121315112 TATTACCTGTAACAGGTTTTGGG - Intronic
1104501711 12:129292603-129292625 TATTAACAATAATAGGTGGCAGG - Intronic
1109696005 13:65958784-65958806 TTTTAGCTATAAAAGTTTGTCGG + Intergenic
1109807460 13:67462289-67462311 TATTTACAAAAACAGGTGGTGGG + Intergenic
1110468621 13:75831788-75831810 TGTTACCTTTAACAGGTGTTTGG - Intronic
1111408550 13:87843141-87843163 GATTAACTGTAACAGGTGGTTGG - Intergenic
1112206297 13:97326672-97326694 TATTTGCTATATTAGGTAGTTGG + Intronic
1112653300 13:101421479-101421501 TATCAGCTTTAACAGGGGCTTGG - Intergenic
1113049537 13:106194626-106194648 TATTAGTTCTAACAGGTTTTTGG - Intergenic
1113303948 13:109056012-109056034 TATTTACAAAAACAGGTGGTAGG - Intronic
1117340482 14:54787676-54787698 GATTAGCCATCACAGGCGGTAGG - Intronic
1119958605 14:78828563-78828585 TATTTACTAAAACAAGTGGTAGG + Intronic
1120182643 14:81360785-81360807 TATTAGTTATAACAGTTTATTGG - Intronic
1120246701 14:82014917-82014939 TCTTAGCTTTCACAGGTTGTTGG + Intergenic
1121276228 14:92669730-92669752 TATTTGCAAAATCAGGTGGTAGG - Intronic
1121662386 14:95645192-95645214 TATTTGCAAAAACAGGTGGTGGG - Intergenic
1127884220 15:63185098-63185120 TATTTGCTATATTAGGTGTTTGG - Intergenic
1130527340 15:84718612-84718634 TATTGGGTATAACATGTGCTAGG - Intergenic
1131850056 15:96531074-96531096 TATTAACTACAACTGGTGTTTGG - Intergenic
1132223385 15:100122244-100122266 TATTAGCTATAACAGGTGGTTGG - Intronic
1133468321 16:6049576-6049598 TAGTAGATATTACAGGTGTTAGG - Intronic
1134296565 16:12951508-12951530 TATTTGCAAAAACAGGTGTTGGG + Intronic
1135121936 16:19773680-19773702 TATTCACAAAAACAGGTGGTGGG + Intronic
1135902909 16:26482444-26482466 TATTAGCTTTAAGAGGTTTTTGG - Intergenic
1140571955 16:76118001-76118023 TGTTTCCTATAACAGGTGGTGGG + Intergenic
1140833109 16:78769675-78769697 TATTAGCTACAACAGGGTTTTGG + Intronic
1144113156 17:12058499-12058521 TATAACCTATAACACATGGTAGG - Intronic
1145827963 17:27891486-27891508 TATTAACAATAACAGTTAGTAGG - Intronic
1146147380 17:30432213-30432235 TATTTACAAAAACAGGTGGTGGG - Intronic
1147547200 17:41411259-41411281 TATTTGCAAAAGCAGGTGGTGGG + Intergenic
1148986159 17:51623540-51623562 TAATAGCCATAACAGGTGTGAGG - Intergenic
1153740408 18:8120167-8120189 TATTTGCAAAAGCAGGTGGTAGG + Intronic
1153914167 18:9731352-9731374 TATTACCTCTACCAGGTGCTTGG + Intronic
1154258386 18:12806087-12806109 TATTAGTTATAACAGTTTTTTGG - Intronic
1155305029 18:24470462-24470484 TATTTGCCCAAACAGGTGGTGGG + Intronic
1162991553 19:14305939-14305961 TATTTACAAAAACAGGTGGTGGG - Intergenic
1163411843 19:17159766-17159788 TATTAGCAAAACCAGGTGGAGGG - Intronic
1164956167 19:32387793-32387815 TATTTGCCAAAACAGGTGGCAGG - Intergenic
1167355643 19:49002362-49002384 TATTTGCAAAAACAGGTGGCTGG + Intronic
925792927 2:7510972-7510994 TATTAGATATAACAGGGGATTGG - Intergenic
926684598 2:15689392-15689414 TCTCAGCAATACCAGGTGGTAGG + Intergenic
927375946 2:22414241-22414263 TATTAGCTCTAACAGTATGTTGG - Intergenic
929413635 2:41725214-41725236 TATTTACAAAAACAGGTGGTGGG - Intergenic
932300347 2:70662765-70662787 GAAGAGCTATAAGAGGTGGTAGG - Exonic
932858427 2:75263469-75263491 TATTTGCAAAAACAGGTGGCAGG - Intergenic
933259245 2:80113531-80113553 TATTTACTAAAACAGGTGGTGGG - Intronic
933627563 2:84618952-84618974 TATTTACAAAAACAGGTGGTGGG + Intronic
939236501 2:139501014-139501036 TATTAGCTAAAAGAGGTTTTTGG - Intergenic
942624186 2:177881691-177881713 TATTAATAAAAACAGGTGGTAGG - Intronic
942984032 2:182118018-182118040 TAATAGCTAAAAGAGGAGGTAGG - Intronic
946041825 2:216789308-216789330 TATTTACAAAAACAGGTGGTGGG + Intergenic
1169189040 20:3645590-3645612 TATTAGGTGTTTCAGGTGGTTGG - Intronic
1170953481 20:20957193-20957215 TATTGGCTATAACACGGGATGGG - Intergenic
1173408351 20:42786975-42786997 TATGTGCAAAAACAGGTGGTGGG - Intronic
1174409397 20:50324108-50324130 TATTTACAAAAACAGGTGGTGGG + Intergenic
1177371022 21:20203566-20203588 AATTACCTATCACAGTTGGTGGG + Intergenic
1177389459 21:20448502-20448524 AATAAGCCATAACATGTGGTTGG + Intergenic
1178269951 21:31180463-31180485 TATTTACAAAAACAGGTGGTGGG + Intronic
1179340461 21:40503504-40503526 TTCTAGCTACAACAGTTGGTGGG - Intronic
1179570807 21:42277871-42277893 TATTAGCTATTACAGATGACCGG - Intronic
1181139616 22:20794820-20794842 TATTTGCAAGAACAGGTGTTGGG - Intronic
1182484375 22:30630530-30630552 AATTAGCTGTAAATGGTGGTGGG + Intergenic
1184993955 22:48189285-48189307 TATTAGGTATAGCATGTGTTTGG + Intergenic
950882119 3:16330418-16330440 CATTAGCTAAGAAAGGTGGTAGG + Intronic
951142936 3:19188463-19188485 TATTAACAAAAACATGTGGTGGG + Intronic
951867474 3:27324189-27324211 TACTAGCTATAACTGGATGTGGG - Intronic
952037388 3:29219443-29219465 TATTTGCAAAAACAGGTGGCAGG + Intergenic
952284902 3:31958774-31958796 TATTTGCTAAAATAAGTGGTGGG - Intronic
952592579 3:34975212-34975234 TATTAGTTTTAACAGTTGTTTGG + Intergenic
954977477 3:54709948-54709970 TAATACCTCTACCAGGTGGTAGG - Intronic
956325775 3:68050873-68050895 GATTTGCTAAAACAGGTGGTGGG + Intronic
956887340 3:73573459-73573481 TATTTAATAAAACAGGTGGTGGG - Intronic
957014920 3:75051946-75051968 TATTATCTATATCATGTGGAAGG + Intergenic
957546953 3:81651461-81651483 GATTAGCTTTAATAGGTGGGAGG - Intronic
959823148 3:110760820-110760842 TATTAGCTGTAACAGTTTTTTGG + Intergenic
961331482 3:126143979-126144001 TATTAGCTCTAACAGTTTTTTGG - Intronic
963507308 3:146203041-146203063 TATCAGCATTAACAGGTGTTTGG - Intronic
965436752 3:168662265-168662287 AATTAACTATAACAGGAGGTTGG + Intergenic
969640037 4:8392211-8392233 TATTTGCAAAAACAGGTGGCAGG + Intronic
970567448 4:17346548-17346570 AATTAGCTATGTCAGGTGGGAGG - Intergenic
971497853 4:27286835-27286857 TATTTACAAAAACAGGTGGTGGG + Intergenic
971902138 4:32674350-32674372 TAGTAGCGATAACAGGTAGATGG + Intergenic
974430879 4:61794031-61794053 TATTAGATAAAAAAGGTGCTAGG + Intronic
974765690 4:66342746-66342768 TATCAGATATAACAAGTGCTGGG - Intergenic
975809707 4:78154484-78154506 TAATAGCTTTAAAAGGTGGGTGG - Intronic
978049542 4:104180441-104180463 TATTAGTTCTAACAGGTTTTTGG - Intergenic
978058695 4:104308835-104308857 TAATAGGTAAAACTGGTGGTAGG + Intergenic
978422952 4:108553513-108553535 GATTAGATATCAAAGGTGGTGGG + Intergenic
980196393 4:129594109-129594131 TATTAGTTCTAACAGGTTTTTGG - Intergenic
982100862 4:151966185-151966207 TAGCAGCTAGCACAGGTGGTTGG - Intergenic
984429719 4:179633220-179633242 TATTAGTTCTAACAGGTTTTTGG + Intergenic
984519161 4:180780082-180780104 TATTAGCTCTAGCAGGTTTTTGG + Intergenic
984834149 4:184003609-184003631 TATTTACAAAAACAGGTGGTGGG - Intronic
985359107 4:189153587-189153609 TATTTACTAAAGCAGGTGGTGGG - Intergenic
986589324 5:9352764-9352786 TATTAACAAAAACAGGTGATGGG - Intronic
988058632 5:26135618-26135640 TGTTACCCATAACAGGTGTTTGG - Intergenic
989622917 5:43402259-43402281 TATTAACTATAACAAGAGATAGG - Intronic
991319152 5:65349704-65349726 AATTAGCTAGAAATGGTGGTGGG + Intronic
992070685 5:73145809-73145831 TATTTTCTATAAAAGGTCGTTGG - Intergenic
992363962 5:76072541-76072563 TATTTGGTATCTCAGGTGGTGGG + Intergenic
992497609 5:77309028-77309050 AATTAGCTGTAAGTGGTGGTGGG + Intronic
992783510 5:80148900-80148922 TATTAGCCTTAACAGGAGCTTGG + Intronic
994047130 5:95322738-95322760 TATTTACAAAAACAGGTGGTGGG - Intergenic
994909462 5:105883998-105884020 TATTATCAATAACAAGTGTTAGG - Intergenic
998196881 5:140081247-140081269 TATTTGCAAAAACAGGTGGCAGG + Intergenic
999556640 5:152750491-152750513 TATTAGCTTTAACAGGTTTTGGG - Intergenic
1000702335 5:164468326-164468348 TATTTACTAAAACAGGTAGTGGG + Intergenic
1000943776 5:167395362-167395384 TATCAGTTCTAACAGGTTGTGGG + Intronic
1001022877 5:168198506-168198528 TATTTACCAAAACAGGTGGTGGG + Intronic
1001342282 5:170858773-170858795 CAATAGCTTTAAAAGGTGGTTGG + Intergenic
1002086352 5:176778070-176778092 TATTTGTAAAAACAGGTGGTAGG - Intergenic
1004197349 6:13516774-13516796 TATGAACTGTGACAGGTGGTGGG + Intergenic
1006140404 6:31925738-31925760 TATTGGCTAAAACAAGTGGCTGG + Intronic
1006702032 6:35982956-35982978 TATAAGCTATAACAGCTGCTAGG - Intronic
1007457026 6:41986646-41986668 TATTAGCTCTAACAGCTTTTTGG + Intronic
1008034069 6:46727787-46727809 CATGAGCTATAACATGTGGATGG + Intronic
1008438894 6:51509757-51509779 TATTTGCAAAAATAGGTGGTAGG + Intergenic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1010798459 6:80145912-80145934 TATTAGCTCTAAGAGCTTGTTGG + Intronic
1010800760 6:80173029-80173051 GATTGGCTATAACAGCTGGCTGG - Intronic
1011207671 6:84917769-84917791 TATTTACAAAAACAGGTGGTAGG - Intergenic
1012772341 6:103454797-103454819 GAATAGCTAAAACAGGTGCTGGG + Intergenic
1012931570 6:105322764-105322786 TGTTTACTAAAACAGGTGGTGGG - Intronic
1014530478 6:122553013-122553035 TACTAACTATAACAGGAGATAGG - Intronic
1019955067 7:4406906-4406928 TATTCGCTAAAACAGGCTGTAGG + Intergenic
1021695889 7:23276101-23276123 TATTTACAAAAACAGGTGGTAGG + Intergenic
1021797537 7:24272176-24272198 TATTTACAAAAACAGGTGGTAGG + Intergenic
1022455819 7:30557413-30557435 TATTTGCAAAAACAGGTGGTGGG - Intergenic
1022607182 7:31826977-31826999 TATTTACAAGAACAGGTGGTGGG + Intronic
1022782320 7:33598922-33598944 TATTTACTAAAACAGGTGTTGGG - Intronic
1023320815 7:38995679-38995701 TAAAAGCTATAAAAGGTGATGGG - Intronic
1024977791 7:55129939-55129961 TATTTGCAAAAACAGGTGGCAGG - Intronic
1028806755 7:95036474-95036496 TATTAGCTATAACTGGCTCTTGG - Intronic
1030525100 7:110643229-110643251 TATTTACAAAAACAGGTGGTGGG - Intergenic
1032734245 7:134676074-134676096 TATTAGTTCTAACAGGTTTTTGG + Intronic
1032922934 7:136569830-136569852 TATTAGTTTTAACAGGTTTTTGG + Intergenic
1034815595 7:154169695-154169717 TATTAGCTATTACAGGACCTTGG - Intronic
1038832585 8:31078013-31078035 TATTAGATAAAACAGGTTTTAGG + Intronic
1039955136 8:42201539-42201561 TATAGGCTAACACAGGTGGTCGG - Intronic
1041718699 8:60956501-60956523 TATTTACAAAAACAGGTGGTTGG + Intergenic
1042459928 8:69052881-69052903 TATTAGTTCTAACAGGTTTTTGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045178402 8:99752392-99752414 TATTTACAAAAACAGGTGGTGGG - Intronic
1045627086 8:104066470-104066492 TATTAGCTATAAGGTGTGTTTGG - Intronic
1045965705 8:108022050-108022072 TGTTAGCTAGAAGATGTGGTGGG - Intronic
1047092469 8:121589186-121589208 TATTAGCTATAACTGGAGATTGG - Intergenic
1047178403 8:122564216-122564238 TATTTGCAAAAACAAGTGGTGGG - Intergenic
1048554958 8:135466707-135466729 TACTAGCTATAAAATGTGGGAGG + Intronic
1052840308 9:33287625-33287647 TATTAAGTATAATAGGGGGTTGG - Intergenic
1053257493 9:36630547-36630569 TACCAGCTATAACATATGGTAGG - Intronic
1055756851 9:79567529-79567551 TATTACCTATAACAGGGAATTGG + Intergenic
1056337064 9:85582529-85582551 TATTAGCTAGGAGTGGTGGTGGG + Intronic
1058764733 9:108170652-108170674 TAGCAGCTAGAGCAGGTGGTGGG - Intergenic
1060009188 9:120028385-120028407 TATTAGCTGGAAGAGGGGGTTGG + Intergenic
1061142812 9:128778866-128778888 TATTAGCAATAACAAGAGATTGG + Intergenic
1186633059 X:11371289-11371311 TATTTACAATAACAGGTGATGGG - Intronic
1186953917 X:14659111-14659133 TATTTGCAAAAACAGGTAGTGGG - Intronic
1188010895 X:25054919-25054941 TATTTACAAAAACAGGTGGTGGG + Intergenic
1188456052 X:30367389-30367411 TATCAGCAATAACAGGAGTTTGG - Intergenic
1190124310 X:47689995-47690017 TATTAACTATAACAGGAGATTGG + Intergenic
1192744677 X:73927213-73927235 TATTAGCTCTAACAGGTCTTTGG + Intergenic
1194616751 X:96113484-96113506 TATTAGTTCTAACAGGTTTTTGG - Intergenic
1194898695 X:99479211-99479233 TATTAGTTTTAACAGGTTTTTGG - Intergenic
1195792155 X:108599687-108599709 TTTTATTTATAACAGGTGGTAGG - Intronic
1196014729 X:110925994-110926016 TATTAGCTATAACTTTTGTTTGG - Intergenic
1196347557 X:114682407-114682429 TATTATCTATAATTGGTGGGCGG + Intronic
1196635543 X:117998402-117998424 TATTAACTATGACAGAGGGTTGG + Intronic
1197021800 X:121699025-121699047 TATTAGTTCTAACAGTTGTTTGG + Intergenic
1197839333 X:130728599-130728621 TATTAACTATAACAGGGGATTGG - Intronic
1199861525 X:151804844-151804866 TATTAATTATAACAAGTGGCTGG - Intergenic
1201857445 Y:18560532-18560554 TAAAAGCAAAAACAGGTGGTAGG + Intronic
1201875876 Y:18759848-18759870 TAAAAGCAAAAACAGGTGGTAGG - Intronic