ID: 1132223479

View in Genome Browser
Species Human (GRCh38)
Location 15:100123075-100123097
Sequence GTGGGGTCCTTGGGAAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132223479_1132223496 26 Left 1132223479 15:100123075-100123097 CCCAACTTTCCCAAGGACCCCAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1132223496 15:100123124-100123146 CTGTGTGGACACGGGGCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 192
1132223479_1132223487 -9 Left 1132223479 15:100123075-100123097 CCCAACTTTCCCAAGGACCCCAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1132223487 15:100123089-100123111 GGACCCCACACTGGGCTGGGTGG 0: 1
1: 0
2: 2
3: 38
4: 276
1132223479_1132223491 11 Left 1132223479 15:100123075-100123097 CCCAACTTTCCCAAGGACCCCAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1132223491 15:100123109-100123131 TGGATGAAGCCTGAACTGTGTGG 0: 1
1: 0
2: 1
3: 16
4: 172
1132223479_1132223493 18 Left 1132223479 15:100123075-100123097 CCCAACTTTCCCAAGGACCCCAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1132223493 15:100123116-100123138 AGCCTGAACTGTGTGGACACGGG 0: 1
1: 0
2: 1
3: 15
4: 176
1132223479_1132223494 19 Left 1132223479 15:100123075-100123097 CCCAACTTTCCCAAGGACCCCAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1132223494 15:100123117-100123139 GCCTGAACTGTGTGGACACGGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1132223479_1132223492 17 Left 1132223479 15:100123075-100123097 CCCAACTTTCCCAAGGACCCCAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1132223492 15:100123115-100123137 AAGCCTGAACTGTGTGGACACGG 0: 1
1: 0
2: 1
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132223479 Original CRISPR GTGGGGTCCTTGGGAAAGTT GGG (reversed) Intronic
901677869 1:10897442-10897464 GGCGGGACCCTGGGAAAGTTTGG - Intergenic
902621912 1:17655789-17655811 ATGGGGTCCTTGGGAAAGCAGGG + Intronic
904261094 1:29288237-29288259 GTGGGGCCCTGGGGAAACTGAGG + Intronic
905646692 1:39629797-39629819 GTGGGGTCCTTGGCAGAACTGGG - Intronic
906168678 1:43706505-43706527 GTGGGGTCATCGAGAAAGGTAGG - Intronic
906393506 1:45440239-45440261 GGGGGGGCCTTGGCAAAGTGTGG - Intronic
910224648 1:84924006-84924028 GAGGGTTCCCTGTGAAAGTTAGG - Intergenic
911956483 1:104242268-104242290 GTGGGCTGCTCTGGAAAGTTAGG + Intergenic
915119368 1:153619075-153619097 CTGGGGTTCTTGAGAAAGTAGGG + Intronic
915324392 1:155073493-155073515 GTTGGCTCCTTGGGAAAGGGTGG + Intergenic
916314731 1:163436678-163436700 GTGTGTACCTTGGGACAGTTGGG + Intergenic
917969052 1:180195674-180195696 GTGGGCTCCAAGGGATAGTTGGG - Intronic
920294342 1:204946763-204946785 GTGGGGGCCTCGGGAAGGGTTGG - Intronic
920432580 1:205928261-205928283 CCGGGGACCTTGGGCAAGTTAGG - Intronic
1062820042 10:528034-528056 GTCGTGTCCTTGGGAATGTAGGG + Intronic
1062899293 10:1130262-1130284 GACGGGTCTTTGGGAAACTTTGG + Exonic
1065724203 10:28654518-28654540 TTGAGGACTTTGGGAAAGTTTGG + Intergenic
1065814146 10:29469652-29469674 GTGGGGACCTTGGGGAAGAGGGG - Intronic
1070668014 10:78359043-78359065 ATGGGGTCCTTGGGCACCTTTGG - Intergenic
1072345411 10:94500268-94500290 CTAGTGTCCGTGGGAAAGTTTGG + Exonic
1072660897 10:97362970-97362992 GTGGAGTCATTGGGACAGTTTGG - Intronic
1075075211 10:119346033-119346055 AAGGGTTCCTTGGGAATGTTTGG - Intronic
1076931153 10:133532818-133532840 GTGAGGTCCCGGGGACAGTTGGG - Exonic
1077460214 11:2705387-2705409 GTGGGGGCTCTGGGAGAGTTGGG - Intronic
1077573000 11:3355352-3355374 GTGGGGTATTGGGGAATGTTGGG + Intronic
1077993007 11:7428788-7428810 GTGGGGACCTTGGTTAGGTTTGG + Intronic
1079419164 11:20270076-20270098 GTTGGGGCCATGGGGAAGTTAGG - Intergenic
1084463424 11:69308806-69308828 GTGGGAGCCTTTGGAAAGCTGGG - Intronic
1084598305 11:70130350-70130372 GGGGGCTCCTTGTGGAAGTTGGG - Intronic
1084607953 11:70183515-70183537 GGGGGGTCCTAGGGAAAACTGGG + Intronic
1086114738 11:83236735-83236757 GAGGGGTCTTTGGAAATGTTGGG + Intronic
1086245485 11:84746946-84746968 ATGGGGTTCTTGGGAAAAGTTGG - Intronic
1087006867 11:93479807-93479829 GGTGGGTGCTTGGGAAGGTTTGG - Intronic
1090213854 11:124942986-124943008 ATGGGGTCCTGGGTAAATTTTGG + Intergenic
1090342137 11:126033305-126033327 GTGGGGTTCTAAGGAAGGTTGGG + Intronic
1090965845 11:131597213-131597235 GTTGGGCCCTTAGGAAACTTAGG + Intronic
1093245148 12:16727350-16727372 GGGAAGTCCTGGGGAAAGTTAGG - Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1101881187 12:108627178-108627200 GTGTGGTCCTTGGTAAAATGGGG - Intronic
1103508326 12:121456065-121456087 GTGCTGTTATTGGGAAAGTTAGG - Intronic
1108146425 13:47482254-47482276 AATGGGTCCTTGGGAAATTTAGG - Intergenic
1109456841 13:62604011-62604033 TTGGCATCCTTGGAAAAGTTGGG + Intergenic
1110455943 13:75690372-75690394 GTGGGGTCCTGGTGACATTTTGG - Intronic
1113216870 13:108051789-108051811 GTTTTGTCCTTGGGATAGTTAGG + Intergenic
1116866689 14:50037257-50037279 GAGGGTTCCTTGAGAAAGTGAGG - Intergenic
1118877427 14:69797088-69797110 GTGGGGCGCTTGCCAAAGTTGGG + Exonic
1119810557 14:77514425-77514447 GTGGGGTATTTGGGTATGTTAGG + Intronic
1120352578 14:83381723-83381745 GCAGGGTGCTTGGGAAAGATTGG + Intergenic
1121989785 14:98545002-98545024 GTGAGGTCATGGGGAAAGTAAGG - Intergenic
1126398795 15:48247851-48247873 CTGGGGTGTTTGGGAAAGTGTGG + Intronic
1128580249 15:68804993-68805015 GTCTGGTCCTTGGGAGAGGTGGG + Intronic
1129741954 15:77993609-77993631 GTGGGGCCCCAGGGAAAGCTGGG - Intronic
1129853175 15:78806698-78806720 CTGTGATCCTTGGGAAAGTTAGG - Intronic
1129893808 15:79089581-79089603 GAGCGGTCCTTGGGAATCTTTGG + Intronic
1130249791 15:82292392-82292414 CTGTGATCCTTGAGAAAGTTAGG + Intergenic
1132223479 15:100123075-100123097 GTGGGGTCCTTGGGAAAGTTGGG - Intronic
1132942472 16:2514790-2514812 GTGGGCTGTTTGGGAAAGCTGGG + Intronic
1133835800 16:9366271-9366293 GTGAGGTCCTTGGCAAGGTTGGG + Intergenic
1135535861 16:23294028-23294050 GTGGGATCCTTGAGAAGGTTTGG - Intronic
1137472865 16:48777207-48777229 TTGGGGTGTGTGGGAAAGTTGGG + Intergenic
1138245869 16:55466983-55467005 GTGGGGTCCTTGGGCAGTTAGGG - Intronic
1141029101 16:80572266-80572288 GAGGGGTCCTTAGGAAAGGGAGG + Intergenic
1141873913 16:86808566-86808588 GTTGAGTCCCTGGGACAGTTTGG + Intergenic
1142413222 16:89926469-89926491 TTGGGGTCCTGGGGAAAGCGGGG - Intronic
1144132372 17:12259325-12259347 GTAGGGTCCTTGGGACACTTTGG - Intergenic
1144791516 17:17862135-17862157 GCTGGGTCCCTGGGAAAGGTGGG + Intronic
1147559213 17:41498746-41498768 GTGGGGTCCTGGAGAAAGAGAGG - Intergenic
1148567827 17:48644189-48644211 CTGGGGCCCTTGGGGCAGTTAGG + Intergenic
1149240973 17:54648594-54648616 GTGGGGTCCAGGGGAAGGTGGGG + Intergenic
1149659403 17:58326517-58326539 GTGGGGTCCTTGGCAACTCTAGG + Intronic
1150320060 17:64206164-64206186 CTGGGGACCTTGGGAAAGGGTGG - Intronic
1152131907 17:78482668-78482690 GTGGGGCCCGTGGGAAGGATGGG - Intronic
1152695441 17:81741629-81741651 GCCGGGTCCTAGGGAAAGTTTGG - Intergenic
1154014687 18:10605648-10605670 GTGGGCTCCTGGGGACAGTGGGG - Intergenic
1154190800 18:12229927-12229949 GTGGGCTCCTGGGGACAGTGGGG + Intergenic
1154305688 18:13229180-13229202 GTGGTGTCCTTGGGACGATTCGG + Intronic
1155804878 18:30156768-30156790 TTGGTGTCCATGGCAAAGTTGGG + Intergenic
1157875795 18:51272368-51272390 GTGGGGGGCTGGGGAAAGATGGG + Intergenic
1162782323 19:13012724-13012746 TTTGGGTGCTTGGGAGAGTTTGG + Intronic
1162959038 19:14115494-14115516 GAGGGCTCCTTTGGAAAATTTGG + Intronic
1163234715 19:16023666-16023688 GAGGGGTCCCTGGGAGAGGTTGG - Intergenic
1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG + Intronic
1164610961 19:29631416-29631438 GAGGGGTCCTTGGGGAGGATTGG + Intergenic
1164672518 19:30080797-30080819 CTGGGGTCCTGGGGGAAGCTGGG + Intergenic
1167843109 19:52138636-52138658 CTGGGGACAATGGGAAAGTTTGG - Intronic
1167967749 19:53161396-53161418 GTGGGTTTCTGGGGAAAGCTGGG - Intronic
1168173069 19:54602554-54602576 GTGGGGTCCATGGGAAAGGCTGG - Intronic
928341542 2:30447328-30447350 GTGGGGTGCGTGGGCAAGCTGGG - Exonic
929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG + Intronic
932404726 2:71505466-71505488 GTGGGATCCTTAGGAAACTCTGG + Intronic
935737844 2:106120426-106120448 GTAGGGTCCGTGGGAAAGGGTGG + Intronic
936264504 2:110992493-110992515 GTGGGGACCTGAGGAAAGATGGG + Intronic
936377464 2:111954175-111954197 GCGGAGACCGTGGGAAAGTTAGG - Intronic
940812703 2:158263234-158263256 ATGGAGGCCTTGAGAAAGTTAGG + Intronic
944731295 2:202520569-202520591 GTAGGGTCCTTGGGAAGGGTTGG - Intronic
944967392 2:204950576-204950598 GTGGGGGCCTTGGGAGACCTTGG + Intronic
945686041 2:212971433-212971455 CTGGGAACCTTGGGAAAATTTGG - Intergenic
946445558 2:219737190-219737212 TTGGGGTCCCTGGGGAAGTGGGG + Intergenic
949052417 2:241904228-241904250 GTGGGGTCTGTGGCAAAGTGAGG + Intergenic
1168762233 20:357129-357151 GTGGGAGCCATGGGAAGGTTTGG - Intronic
1169375942 20:5066698-5066720 GGAGGGTCCTTGGGTATGTTTGG - Intergenic
1169433911 20:5567281-5567303 GTGGGGTCCATGGAAATGGTTGG + Intronic
1169648453 20:7840792-7840814 GTGGTTTCCTTGGGAAAGTCTGG - Intergenic
1171174364 20:23040394-23040416 TTGGGGTCCTTGTGAAATTGAGG + Intergenic
1172945332 20:38683351-38683373 GTGGGGTCCTCTGGAAACTAAGG - Intergenic
1173522997 20:43712823-43712845 ATGGGGTGGCTGGGAAAGTTAGG - Intronic
1175228956 20:57461470-57461492 GTGGGGTCCTTTGGCACGTGGGG - Intergenic
1175948900 20:62571936-62571958 GTGGGGCCTGTGGGAAAGTGGGG + Intergenic
1177757187 21:25362011-25362033 GTAGGGACCTCGGGAAAGGTGGG - Intergenic
1178694959 21:34784920-34784942 GTGGGGTCCTTGTAAGAGTGTGG + Intergenic
1179834950 21:44024956-44024978 GTGGAGTCCGGGGGAAAGTGAGG - Intronic
1179886718 21:44317314-44317336 GTGGGTTCCCTGGGAATGCTCGG - Intronic
1181257634 22:21574155-21574177 GTGGGGGGCTTGGGGAGGTTAGG - Intronic
1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG + Intronic
1183728002 22:39600132-39600154 ATGGGGTCCTTGGGAGAATTAGG + Intronic
949987594 3:9552930-9552952 GAGGGGGCCATGAGAAAGTTGGG + Intronic
951907733 3:27721344-27721366 GTGTGGTCCTGGGGAAGGTCCGG - Intronic
953061034 3:39429063-39429085 GTAGAGTCCTTGGAAAAGTCTGG - Intergenic
954791392 3:53135937-53135959 GTGAGGGCCTTGGGAGAATTCGG + Intergenic
954970459 3:54647450-54647472 GTGGGGTCCCTGGTGAAGCTAGG + Intronic
955050439 3:55405555-55405577 GTGATGTCCTTGGGAGATTTTGG - Intergenic
956603584 3:71049513-71049535 GATGTTTCCTTGGGAAAGTTTGG - Intronic
957363037 3:79183625-79183647 GTGTGGTCCTTGGGGATGGTTGG + Intronic
960137931 3:114124385-114124407 GTTGGGTTCTTAGGAAAGTTTGG + Intergenic
967833751 3:193943615-193943637 GTCTGCTCCTTGGGAAAGCTGGG - Intergenic
968789650 4:2650767-2650789 ATGCGGTCCTTGGTAAAGGTAGG - Intronic
969331510 4:6475872-6475894 GTGGGGCCTTTGGGAGATTTGGG + Intronic
971606973 4:28670374-28670396 GTGGGATTCTTGCTAAAGTTGGG - Intergenic
974233267 4:59145745-59145767 CTGGGGCCCATGGGAAAGTGGGG - Intergenic
974564603 4:63566902-63566924 GTGGTGTCCTTGGGAAAGGATGG - Intergenic
975179183 4:71323889-71323911 TTGGCATCCTTGGGAACGTTGGG + Intronic
978561966 4:110042892-110042914 AAGGGGTCCTAGGGAAACTTAGG + Intergenic
979378881 4:119984599-119984621 GTGGTTTCCTTGGGAAAGTATGG + Intergenic
981782465 4:148444036-148444058 GTGGGCCCCGCGGGAAAGTTGGG - Intronic
981902836 4:149887051-149887073 GTCTGGACCTTGGGAAAGATTGG - Intergenic
986532730 5:8756174-8756196 GTTGGGGCCTAGGGAAACTTGGG - Intergenic
986720370 5:10556799-10556821 GTGGGATCCTTGGGGAAGCCAGG + Intergenic
990016832 5:51073453-51073475 CTGGGGTCCATGGTAAAGTCTGG + Intergenic
996658892 5:125975263-125975285 GTGGGGAAGTTTGGAAAGTTTGG - Intergenic
998404747 5:141867965-141867987 GTGGGGTGCTTGGTACAGTGGGG - Intronic
999358026 5:150955436-150955458 CTGGGGTCCATGGCAAAGTTGGG + Intergenic
1001816135 5:174670923-174670945 GTGGGTTCCTTGGGGAGGTATGG - Intergenic
1002662824 5:180802989-180803011 TTGGGGTCCTGGGAAAACTTGGG - Intronic
1003364944 6:5464394-5464416 GTGGAGTCATTGGGAATCTTGGG + Intronic
1003397926 6:5769512-5769534 GGGAGGTCCTTGGGGCAGTTTGG + Intronic
1006183509 6:32167694-32167716 GAGGGGTCTTGGGGAAAGTTGGG - Intronic
1006840473 6:37025386-37025408 GTGGGGTCTTTGGGAGAGTCAGG + Intronic
1007312680 6:40959128-40959150 GTGGGGTTCTGGGGAAGATTCGG + Intergenic
1008557959 6:52693671-52693693 GTGTGGGCCTTGGGAAACTTTGG + Intergenic
1009338020 6:62518072-62518094 CTAGGGTCTTTTGGAAAGTTAGG + Intergenic
1010260582 6:73811317-73811339 GTGGGGAACTTTGGAAAGATTGG + Intronic
1013563656 6:111333117-111333139 GTGGAGAACTTGGGAAAGTAAGG - Exonic
1013932939 6:115556741-115556763 ATGGGGTCCTTCGGAGAGTGGGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG + Intergenic
1019500492 7:1362192-1362214 TTGGGGTCCGTGGGAGAGCTGGG + Intergenic
1019740686 7:2671447-2671469 GTTGGGGGCTTGGGAAAGGTGGG + Intergenic
1022533829 7:31083676-31083698 GTGGGGTCCTTGGCACACCTTGG - Intronic
1024001859 7:45195043-45195065 GTCTGGACCTTGGGAAGGTTTGG + Intergenic
1024324639 7:48099511-48099533 GTGCGGACCTTGGCAATGTTGGG + Intronic
1025150366 7:56542289-56542311 CAGAGGTCATTGGGAAAGTTGGG - Intergenic
1030297979 7:107947870-107947892 GTGGGGACATTTGGAAATTTGGG - Intronic
1032082084 7:128864483-128864505 GAGGGGTCAGAGGGAAAGTTTGG - Intronic
1032257743 7:130310814-130310836 GTGGGGTCCATGGTACACTTCGG - Exonic
1035553157 8:545051-545073 GTCTGGTCCTGGGGAAGGTTTGG - Intronic
1036917098 8:12814692-12814714 CTGGGGACCTTGAGAAAGGTAGG - Intergenic
1037246929 8:16845783-16845805 CTGGTGTCCTTGAGAGAGTTGGG + Intergenic
1037530388 8:19767029-19767051 GTTGTGTCCATGGGAAAGGTTGG - Intergenic
1037786377 8:21905831-21905853 TTAGGGCCCTTGGGAAAGGTGGG - Intergenic
1038328739 8:26591283-26591305 GTGGGGCCCATGGGAATGCTAGG + Intronic
1044275139 8:90290543-90290565 GTGGGATGCTTCGGAAAGGTAGG - Intergenic
1047249657 8:123172196-123172218 GTGGGGTCCTTCTGAATGTGGGG - Intergenic
1047790521 8:128199006-128199028 TTGGGGTCACTGGCAAAGTTGGG - Intergenic
1047799944 8:128298447-128298469 GTGGGGTCCTTGGGCAGGGCAGG + Intergenic
1049421967 8:142521004-142521026 GTGGGATCCCTGGGAAACTCAGG + Intronic
1050048640 9:1575518-1575540 GTAGGGTCCATGGGTAGGTTTGG + Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1055637960 9:78296628-78296650 GGGGGGTGCTTAGAAAAGTTTGG + Intergenic
1055802302 9:80051963-80051985 CTGGGGTCCATGGTAAAGTCAGG - Intergenic
1056935521 9:90912746-90912768 GCGGTGTCCTGGGGACAGTTAGG - Intergenic
1057798724 9:98176340-98176362 GTGGGGTGCTGGGGAAAGAAGGG - Intronic
1058895511 9:109397457-109397479 GTGGGCTCTTTGGGAAAAATGGG - Intronic
1059437622 9:114285970-114285992 GTGGGGTCCTTGGGAATGAGAGG + Intronic
1060291029 9:122302793-122302815 GTGCAGTCCTTGTGGAAGTTTGG - Intronic
1062391364 9:136335253-136335275 TTGGGGTCCATGGGAAAGCAGGG - Intronic
1186346451 X:8698057-8698079 TTGGGATCCTTGGGAATCTTTGG - Intronic
1190099812 X:47513824-47513846 GTGTGGTTGATGGGAAAGTTTGG - Intergenic
1194455158 X:94094494-94094516 GTGCGGTTCTTAGGGAAGTTTGG + Intergenic
1195998430 X:110755420-110755442 GTGGGCTCCTTGGAAATTTTAGG + Intronic
1198931608 X:141867557-141867579 GAGGGGTTTTTGGGCAAGTTAGG - Intronic
1199082923 X:143595973-143595995 CCTGGGTCCTTGGGAAAGCTTGG - Intergenic