ID: 1132226253

View in Genome Browser
Species Human (GRCh38)
Location 15:100144012-100144034
Sequence TGGAGCCTTCTCAGGGTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 2, 1: 0, 2: 2, 3: 20, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132226243_1132226253 19 Left 1132226243 15:100143970-100143992 CCACCCAGCACCTGGTCATTCTG 0: 2
1: 0
2: 2
3: 30
4: 313
Right 1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG 0: 2
1: 0
2: 2
3: 20
4: 182
1132226247_1132226253 9 Left 1132226247 15:100143980-100144002 CCTGGTCATTCTGTGCTTCTGGA 0: 2
1: 0
2: 3
3: 27
4: 217
Right 1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG 0: 2
1: 0
2: 2
3: 20
4: 182
1132226244_1132226253 16 Left 1132226244 15:100143973-100143995 CCCAGCACCTGGTCATTCTGTGC 0: 2
1: 0
2: 0
3: 19
4: 181
Right 1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG 0: 2
1: 0
2: 2
3: 20
4: 182
1132226245_1132226253 15 Left 1132226245 15:100143974-100143996 CCAGCACCTGGTCATTCTGTGCT 0: 2
1: 0
2: 1
3: 14
4: 202
Right 1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG 0: 2
1: 0
2: 2
3: 20
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132226253 Original CRISPR TGGAGCCTTCTCAGGGTATG TGG Intronic
900743670 1:4345640-4345662 GGGCTCCTTCTCAGGCTATGTGG + Intergenic
901198000 1:7451085-7451107 TGGAGCCTCAGCAGGGTCTGGGG - Intronic
903180371 1:21602175-21602197 TGGAGCCCTCTCAGGGGACCTGG + Intronic
903369973 1:22829232-22829254 TGGAGCCTTGGCAGGGAAGGTGG + Intronic
905694948 1:39967287-39967309 GGGAGGCTTCTCAGGGTATTTGG + Intronic
906521113 1:46467458-46467480 TGGGGCCTTCTCAGGGTAGGTGG + Intergenic
906726373 1:48047495-48047517 GGGAGCCTTTTCAGAGGATGTGG + Intergenic
909931711 1:81504847-81504869 TTGAGCCGCCCCAGGGTATGAGG + Intronic
911562890 1:99428338-99428360 TGGTTCATTCTCAGAGTATGAGG - Intergenic
911679677 1:100700697-100700719 TGGAGTCTTCTCAGCCCATGAGG + Intergenic
915421089 1:155782320-155782342 TGGAGCCATCTCTGAATATGTGG - Intronic
918961349 1:191282432-191282454 TGCAGCCTTCTCAGTAGATGGGG - Intergenic
920828696 1:209446377-209446399 TAGTGCCATCTCAGGGGATGTGG - Intergenic
921670683 1:217920711-217920733 TAGAGCCTTCAGAGGGTGTGTGG + Intergenic
922890210 1:229056166-229056188 TGCAGACTTCTCTGGGTAGGTGG + Intergenic
1062801234 10:382022-382044 TGGAGCCGTCTGTGGGTTTGGGG - Intronic
1065683068 10:28257083-28257105 TAGAACCTTCTCAGGGATTGTGG - Intronic
1069835818 10:71307447-71307469 TGGTACCGTCTCAGGGTGTGTGG - Intergenic
1070626372 10:78054056-78054078 GTGAGCTTTCCCAGGGTATGGGG + Intronic
1070764065 10:79046464-79046486 TGGTGCATTCTCAGGGTGTCTGG + Intergenic
1071143351 10:82539001-82539023 TGAAGCCCTCTCAGGGTATTAGG - Intronic
1072298757 10:94038548-94038570 CTGAGCTTTCTCAGGGTTTGAGG - Intronic
1072547495 10:96450791-96450813 GGGAGAGTTTTCAGGGTATGGGG + Intronic
1074405701 10:113178670-113178692 TGGAGCATTCTGAGGGTGGGGGG - Intergenic
1074998689 10:118779369-118779391 TGCAGTCTTCTCAGGGTTGGTGG + Intergenic
1075078670 10:119368462-119368484 TGGAGACATCACAGGGCATGGGG - Intronic
1076175088 10:128362284-128362306 ATGAGCCTTCTCAGGGGATATGG - Intergenic
1076427920 10:130380631-130380653 AGGAGCCTTCCCAGAGAATGAGG - Intergenic
1077274361 11:1696762-1696784 TGGAGCCTTCAGAGAGTGTGTGG + Intergenic
1078541446 11:12216706-12216728 TGGAGCCTTGTCACAGTGTGGGG + Intronic
1082281983 11:50280030-50280052 TGGAGCCCTCTCAAGCTATTTGG - Intergenic
1084437582 11:69153238-69153260 TGCAGCATTCTCAGGGGAAGAGG + Intergenic
1085329425 11:75635651-75635673 TCGAGCCTTCTCACAGTCTGAGG + Intronic
1085341901 11:75737244-75737266 AGGAGCCTTCTCAGCTTATCTGG - Intergenic
1087424046 11:97967365-97967387 TGGAGCCTTCCCAGATTATAGGG + Intergenic
1087584925 11:100106467-100106489 GGGAGCATTCTGAGGGAATGAGG + Intronic
1089182138 11:116590422-116590444 TGGAGCCCTCTCAGGAGGTGGGG - Intergenic
1090282601 11:125469064-125469086 TGGAGCCTACTCAGGGAAGGAGG - Intronic
1093594925 12:20948631-20948653 TGGAGCCTTCCCAGGTTAGAGGG + Intergenic
1093733731 12:22595137-22595159 TGGACCTTTCTGAGGGTGTGGGG + Intergenic
1094424429 12:30303894-30303916 TGCAGACTTCTAAGGGTAGGGGG - Intergenic
1096114391 12:49046804-49046826 TGGGAACTTCTCAGGGTGTGAGG + Intronic
1097346612 12:58500099-58500121 TGGAGCCACCACAGGGTTTGAGG + Intergenic
1099315975 12:81082785-81082807 TGAAGCTTTCTCAGAGTAAGCGG - Intronic
1099418637 12:82424907-82424929 TAGAGCCTTCAGAGGGTCTGTGG + Intronic
1101345541 12:103882900-103882922 GGGAGCCTTCTCAGAGGAGGGGG - Intergenic
1102457300 12:113078620-113078642 TGGTGCCTTCTCAGGGTCACCGG + Intronic
1102525008 12:113506162-113506184 TGGGGCCATCTGAGGGTCTGGGG - Intergenic
1102720832 12:115014537-115014559 TGGAGCCTTCGGAGGGAGTGTGG - Intergenic
1103522558 12:121546118-121546140 TGGAGCATACACAGTGTATGGGG - Intronic
1104761698 12:131300751-131300773 TGCAGCCTTCACAGGGGATGGGG + Intergenic
1104818075 12:131660034-131660056 TGCAGCCTTCACAGGGGATGGGG - Intergenic
1104914538 12:132257927-132257949 TGGACCCTCCTCAGGGAATGCGG - Intronic
1104933543 12:132352907-132352929 TGGTGCCTTCTCTGGGTTTCCGG + Intergenic
1108524748 13:51277314-51277336 TGGAGCCTCCACAGGGTGGGAGG + Intronic
1108564879 13:51686066-51686088 TAGAGCTTTCTCAGAGTTTGTGG + Intronic
1113208187 13:107941752-107941774 TGGAGCCTGCTCAGGGGAAGAGG - Intergenic
1113542387 13:111119040-111119062 TGGAGCCTTCTGAGGGCACGAGG - Intronic
1114866889 14:26606506-26606528 TTGAGCTTTCTCAAGGGATGTGG + Intergenic
1115311705 14:31984915-31984937 TGGAGCCTTCTCTGGCAAGGAGG + Intergenic
1115786457 14:36831508-36831530 TGTAGCATTATCAGGGTATATGG + Intronic
1116582682 14:46662295-46662317 TAGAGCCTTCTCAGGATTTCTGG - Intergenic
1123035440 14:105469994-105470016 TGGGGCCTTCCCAGGGCAGGCGG + Intronic
1123058738 14:105584788-105584810 TGTTGCCTTCCCAGGGAATGTGG + Intergenic
1123083065 14:105705014-105705036 TGTTGCCTTCCCAGGGAATGTGG + Intergenic
1123683333 15:22779326-22779348 TGCAGCCATCTCAGGGTAGGTGG - Intronic
1125716796 15:41823990-41824012 GGGAGTCTTCTCAGGGGGTGGGG - Exonic
1126490713 15:49232751-49232773 TGGAGGCATCTAGGGGTATGTGG - Intronic
1126982130 15:54255923-54255945 TGGAGCATTTTCAGGTGATGGGG + Intronic
1129059571 15:72849905-72849927 TGGTGCCTTCTCAGGCTGTCTGG + Intergenic
1129111631 15:73340431-73340453 TGGGGGTTTCTCAGGGTCTGAGG + Intronic
1129295372 15:74597152-74597174 TTGAGCCGCCCCAGGGTATGAGG + Exonic
1129624435 15:77181816-77181838 GGGTGCCTTCTCAGGGTCTGGGG + Exonic
1130486827 15:84402786-84402808 TGGGGCCTTCTCAATGGATGTGG - Intergenic
1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG + Intronic
1132249684 15:100325904-100325926 TGGTTCCTTCTGAGGCTATGAGG - Intronic
1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG + Intronic
1136091474 16:27923290-27923312 AGGAGCCTTCTCGGGGTACAGGG - Intronic
1138936686 16:61734949-61734971 TGGAGGCTTCTCAGGGCATGTGG - Intronic
1139949136 16:70660787-70660809 TGGAGCCTGCCCAAGGGATGTGG + Intergenic
1140206221 16:72935806-72935828 TGTAGCCTTCCCAGGGTCTTGGG - Intronic
1142891986 17:2949717-2949739 TGCAGCCATCTCAGGGTGTGTGG + Intronic
1143130226 17:4672962-4672984 TGGAGCCCACTGAGGGCATGGGG + Exonic
1146486646 17:33248616-33248638 TGGAGCCTCCAGAGGGTGTGTGG - Intronic
1146724125 17:35143699-35143721 GGGAGCCGTCGCAGGGTTTGAGG - Intergenic
1147757629 17:42779464-42779486 TGGATCCTTCCTAGGGGATGGGG + Exonic
1155921909 18:31611816-31611838 TGGGGCCTGCACAGGGAATGGGG + Intergenic
1156305796 18:35877076-35877098 TGGAGCCTTCTCAGATTAGAGGG - Intergenic
1156535777 18:37863202-37863224 TGGAGCCTTAGCAGGGGCTGTGG + Intergenic
1156838363 18:41582576-41582598 TGGTTCCTTCTGAGGCTATGAGG - Intergenic
1159955582 18:74516284-74516306 AGGCGCCTTCTCTGGGTCTGGGG + Exonic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
925440349 2:3880087-3880109 TGGTTCCTTCTGAGGGTGTGAGG + Intergenic
927945376 2:27132291-27132313 TGGAGCCATCCCAGGCTGTGAGG + Exonic
931225157 2:60323056-60323078 TGGATCTTTCTCAGTGAATGGGG - Intergenic
931369411 2:61648482-61648504 TAGAGCCTTCAAAGGGGATGTGG - Intergenic
935827393 2:106965091-106965113 GGGAGCGTTCTCAGGAGATGTGG + Intergenic
936680931 2:114770270-114770292 AGGAGCCTTCTAGAGGTATGAGG - Intronic
937363743 2:121246146-121246168 TGCATCATTCTCAGGGCATGAGG - Intronic
937536610 2:122896553-122896575 TTGGGCCTTCTCAGAGAATGTGG - Intergenic
941046825 2:160685526-160685548 TGGAACATTGTCAGGATATGGGG + Intergenic
942705259 2:178764596-178764618 TGAAGCCTTCCCAGAGGATGCGG - Exonic
944472791 2:200072861-200072883 TGGAGCCTTCGGAGGGACTGTGG - Intergenic
947091602 2:226518349-226518371 TAGAGCCTTCTGAGGGAGTGGGG - Intergenic
948185974 2:236021617-236021639 TGGAGCTTTCACAGGGTATCTGG + Intronic
948571819 2:238922508-238922530 TGGGTCCTTCTCAGGCTGTGTGG - Intergenic
948814644 2:240503602-240503624 TGGAGCTTGTTCAGGGTCTGGGG - Intronic
948841691 2:240653718-240653740 TGGAGCAATCTCAGTGCATGGGG - Intergenic
948899216 2:240947726-240947748 TGAAGCCTTGTCAGGGCCTGAGG - Intronic
1169028519 20:2390001-2390023 TGGAGGCTTCTCTGGGAATGAGG - Intronic
1169950762 20:11040887-11040909 TGGATCTTACTCAAGGTATGAGG - Intergenic
1170583636 20:17717302-17717324 TGGAGTGTTCTCAGGGCATAGGG + Intronic
1172894617 20:38291768-38291790 TGGTCCCATCTCAGGGCATGTGG + Intronic
1175862902 20:62159652-62159674 GGGAGCCTGCTCAGGGTTTGGGG + Intronic
1176081448 20:63275366-63275388 GGGAGCCTCCTGGGGGTATGGGG + Intronic
1176115955 20:63432008-63432030 TGGAGCCTTCCCTGTGGATGGGG - Intronic
1179051175 21:37889640-37889662 TGGAGCCTTCAGAGGGAGTGTGG - Intronic
1179072524 21:38084950-38084972 TGGGCCCTTCTCAGGGCATCAGG + Intronic
1179285467 21:39974285-39974307 TGGAGCCTTCAGAGGGCATGAGG - Intergenic
1179311370 21:40198785-40198807 TGGAGCATGAACAGGGTATGTGG - Intronic
1179616216 21:42584959-42584981 TGCAGACTTCTCTGGGTAGGTGG + Intergenic
1179654174 21:42834903-42834925 TGGAGCCTACAGAGGGGATGGGG - Intergenic
1180955506 22:19739580-19739602 TGGGGCCTCCTCAGGGCCTGCGG + Intergenic
1182509535 22:30809126-30809148 TAGAGCCTTCACAGAGAATGTGG + Intronic
1182776786 22:32837303-32837325 TGGAGCACTCTCAGGGGATAGGG + Intronic
1183311778 22:37113711-37113733 TGGTTCCTTCTGAAGGTATGAGG - Intergenic
1184473259 22:44707599-44707621 TGGGGCCTGCTCTGGGTCTGGGG - Intronic
949627748 3:5887187-5887209 TGGACCTTTATCAGGGTCTGTGG - Intergenic
951397842 3:22192020-22192042 TGGAGCCATTTCAGGGTAGATGG - Intronic
951966515 3:28391793-28391815 TGGCTCCTTCTTAGGGGATGAGG - Intronic
954427033 3:50448850-50448872 TGGGGTGTTCTCAGGGTCTGTGG - Intronic
962837790 3:139204153-139204175 TGGAGTCTTCTCAGGGGCAGAGG + Intronic
963936103 3:151055124-151055146 GGGAGCCTTCTCAGGTTAGTAGG + Intergenic
966541660 3:181098166-181098188 TGGAGCCTTTTGTGGGTATCAGG - Intergenic
968899841 4:3425970-3425992 TGGGGCCTGCACAGGGTAGGGGG + Intronic
969316560 4:6384966-6384988 TGGAGCCTTCCCAGGATTAGAGG + Intronic
969884168 4:10200455-10200477 TGGAGTCTTCTAAGGTTTTGGGG + Intergenic
972439515 4:39073142-39073164 TGAATCAGTCTCAGGGTATGAGG + Intronic
974255671 4:59451280-59451302 CAGAGCCTGCTGAGGGTATGGGG - Intergenic
976383700 4:84430847-84430869 TGGAGACTCCTCAGTGTAGGAGG + Intergenic
980986591 4:139701357-139701379 TGGACCCTTCCCAGGGTCTGAGG - Intronic
981091133 4:140733674-140733696 TGAAGTCTTCACAGGGTATATGG + Intronic
982559596 4:156913932-156913954 TGGGGACTTCTAAGGGTATTAGG + Intronic
983064332 4:163191741-163191763 TGGAGCCTTCCCAGGCTAGAGGG + Intergenic
984237825 4:177182322-177182344 TGGAGCATGCTCATGGTATCTGG - Intergenic
984816046 4:183837133-183837155 TGGAGCTTTCTCGGGGAGTGGGG + Intergenic
985206343 4:187541574-187541596 TGGAGCCTTCGCAGAGTGGGTGG - Intergenic
985889054 5:2701622-2701644 TGGAGCCCTCAGAGGGTAGGAGG - Intergenic
997039175 5:130231915-130231937 TGGAGGCTTCAGAGGGTGTGTGG - Intergenic
997407871 5:133666406-133666428 TGGAGGCTTTTCAGGGAATAGGG - Intergenic
1003200542 6:3956278-3956300 TGGTACCTACTCAGGCTATGGGG + Intergenic
1003248091 6:4401031-4401053 TGTAGCCTTCTCTGAGGATGGGG - Intergenic
1004341989 6:14816087-14816109 AGGAGCCTTCTGAGGGTTTGGGG + Intergenic
1004435509 6:15589220-15589242 TGGAGACTTCTGAGGCTGTGAGG - Intronic
1005670677 6:28103059-28103081 TGGGGGCTTGTCAGGGGATGGGG + Intergenic
1012737404 6:102967417-102967439 TAGAGCTTTCTCAGGCTAAGGGG + Intergenic
1013152957 6:107464205-107464227 TGGAGCCTTCTCAGGGTATGTGG - Intergenic
1013351687 6:109311645-109311667 TGGACTCTTCTCAGGGCATCTGG - Intergenic
1015403299 6:132811161-132811183 TGGTTCCTTCTGAGGGTGTGAGG - Intergenic
1017135826 6:151146700-151146722 TGGAGCCTTCAGAGGGAGTGTGG - Intergenic
1017411042 6:154168302-154168324 TGGTGCCTTCACAGGGAACGTGG - Intronic
1019747732 7:2709882-2709904 TGGAGGCTACGCAGGGCATGGGG + Intronic
1022500262 7:30878287-30878309 TGGGGCCCTCACTGGGTATGTGG + Intronic
1022766784 7:33421733-33421755 TGAGGCCTTCTCAGAGGATGGGG - Intronic
1023767714 7:43527351-43527373 TGGAGCCTTCAGAGGGAGTGTGG - Intronic
1024231311 7:47366011-47366033 TGGAGGCATCTGAGTGTATGTGG - Intronic
1025783439 7:64622297-64622319 TGGAGCCTTCCCAGGTTAGAGGG - Intergenic
1028251294 7:88542472-88542494 TGGAGCCTTCCCAGAGTAGAGGG + Intergenic
1028919901 7:96299293-96299315 TGTAACCTTCTCAGGGTCTAGGG + Intronic
1029172455 7:98640622-98640644 TGCTGCCTTCTCAGGCCATGAGG - Intergenic
1030218335 7:107070211-107070233 TTGAGCCTTTTCAGGGTTTTGGG + Intronic
1030528850 7:110687022-110687044 TGGAACTTGTTCAGGGTATGTGG - Intronic
1033626285 7:143112906-143112928 TGCAGATTTCTCAGGGTAGGTGG - Intergenic
1034549761 7:151813069-151813091 CGGAGCCTGCCCAGGGTGTGTGG + Intronic
1035894705 8:3386403-3386425 TGGAGCCCTCTCAGGAAGTGTGG - Intronic
1038326927 8:26578756-26578778 TGGAGCCTTCTCCGGGTCCTTGG + Intronic
1040973267 8:53160862-53160884 TGAAGCTCTCTCAGGTTATGTGG - Intergenic
1041107093 8:54454352-54454374 TGGAGTTTTCCCAGGGTTTGCGG + Intergenic
1042376493 8:68058132-68058154 TTGGGCCTACTCAGGGAATGAGG - Intronic
1042965059 8:74342198-74342220 TGGAATCTTCCCAGTGTATGAGG - Intronic
1046146694 8:110170725-110170747 TGGATCCCTCTCATGGCATGTGG - Intergenic
1047004123 8:120601924-120601946 TGGAGCCTTATCTGGCTATGTGG - Intronic
1048491744 8:134900692-134900714 TAGAGCCTTCCCAGGGAGTGTGG - Intergenic
1049346394 8:142141381-142141403 TGGCGTCTTCTCTGGGTAAGAGG - Intergenic
1049408212 8:142460979-142461001 TTGAACCCTCTTAGGGTATGAGG - Intronic
1049859640 8:144889860-144889882 TGGGGGCTTCTCAGGGTACGGGG - Intronic
1053272035 9:36756799-36756821 TGGAGCTATCTCATCGTATGGGG + Intergenic
1053458489 9:38250323-38250345 TGGGCCCTGCTCAGGGTCTGAGG + Intergenic
1056509368 9:87288509-87288531 TGGACCCTGCCCAGGGTAAGAGG + Intergenic
1056672088 9:88639019-88639041 TGCAGCCATCTCTGGGTAGGAGG - Intergenic
1060772562 9:126343148-126343170 GGGAGCCTTCTTAGGCTAGGGGG + Intronic
1203452813 Un_GL000219v1:136320-136342 TGGAGCTTTCTCTGTGTTTGGGG + Intergenic
1185962779 X:4563928-4563950 TGGAGCCTTCAGAGGATATGTGG + Intergenic
1187134452 X:16533336-16533358 TTGAGCCTTCTCTGGCTAGGAGG - Intergenic
1188743308 X:33811485-33811507 TGCAGCCCTCTGAGTGTATGTGG + Intergenic
1189196985 X:39161290-39161312 TGGAGCATTTTCAGGGCAAGAGG + Intergenic
1189377710 X:40478671-40478693 TGGGGCCTCCTCAGGGTTGGGGG + Intergenic
1189552549 X:42108371-42108393 GGGAGCCTGGTCAGGGTAGGAGG + Intergenic
1198851661 X:140970684-140970706 TTGACCCTTCTCTGGGAATGGGG - Intergenic
1199211798 X:145220904-145220926 TAGAGCCTTCAGAGGGAATGTGG - Intergenic
1199586166 X:149418831-149418853 TGGAGACATCTGAGGGTGTGAGG - Intergenic
1199809961 X:151339407-151339429 TAGAGCCTTCAGAGGGAATGTGG - Intergenic
1202369357 Y:24186657-24186679 TGGGGCCTTCTCAATGGATGTGG - Intergenic
1202369362 Y:24186677-24186699 TGGGGCCTTCTCAATGGATGTGG - Intergenic
1202501423 Y:25483440-25483462 TGGGGCCTTCTCAATGGATGTGG + Intergenic
1202501428 Y:25483460-25483482 TGGGGCCTTCTCAATGGATGTGG + Intergenic