ID: 1132227038

View in Genome Browser
Species Human (GRCh38)
Location 15:100150737-100150759
Sequence CCTGCGGAGGACTCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132227031_1132227038 -5 Left 1132227031 15:100150719-100150741 CCGCCACATCTCACTGGCCCTGC 0: 1
1: 1
2: 6
3: 52
4: 381
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227027_1132227038 10 Left 1132227027 15:100150704-100150726 CCAGCTCAGCCTGGCCCGCCACA 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227033_1132227038 -8 Left 1132227033 15:100150722-100150744 CCACATCTCACTGGCCCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227028_1132227038 1 Left 1132227028 15:100150713-100150735 CCTGGCCCGCCACATCTCACTGG 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227023_1132227038 24 Left 1132227023 15:100150690-100150712 CCTGCCCTGTAGGGCCAGCTCAG 0: 1
1: 0
2: 5
3: 32
4: 263
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227025_1132227038 19 Left 1132227025 15:100150695-100150717 CCTGTAGGGCCAGCTCAGCCTGG 0: 1
1: 1
2: 1
3: 52
4: 603
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227024_1132227038 20 Left 1132227024 15:100150694-100150716 CCCTGTAGGGCCAGCTCAGCCTG 0: 1
1: 0
2: 2
3: 32
4: 442
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227030_1132227038 -4 Left 1132227030 15:100150718-100150740 CCCGCCACATCTCACTGGCCCTG 0: 1
1: 0
2: 2
3: 51
4: 427
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132227038 Original CRISPR CCTGCGGAGGACTCCACAGT GGG Intronic