ID: 1132227038

View in Genome Browser
Species Human (GRCh38)
Location 15:100150737-100150759
Sequence CCTGCGGAGGACTCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132227028_1132227038 1 Left 1132227028 15:100150713-100150735 CCTGGCCCGCCACATCTCACTGG 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227033_1132227038 -8 Left 1132227033 15:100150722-100150744 CCACATCTCACTGGCCCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227023_1132227038 24 Left 1132227023 15:100150690-100150712 CCTGCCCTGTAGGGCCAGCTCAG 0: 1
1: 0
2: 5
3: 32
4: 263
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227025_1132227038 19 Left 1132227025 15:100150695-100150717 CCTGTAGGGCCAGCTCAGCCTGG 0: 1
1: 1
2: 1
3: 52
4: 603
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227024_1132227038 20 Left 1132227024 15:100150694-100150716 CCCTGTAGGGCCAGCTCAGCCTG 0: 1
1: 0
2: 2
3: 32
4: 442
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227027_1132227038 10 Left 1132227027 15:100150704-100150726 CCAGCTCAGCCTGGCCCGCCACA 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227030_1132227038 -4 Left 1132227030 15:100150718-100150740 CCCGCCACATCTCACTGGCCCTG 0: 1
1: 0
2: 2
3: 51
4: 427
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132227031_1132227038 -5 Left 1132227031 15:100150719-100150741 CCGCCACATCTCACTGGCCCTGC 0: 1
1: 1
2: 6
3: 52
4: 381
Right 1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132227038 Original CRISPR CCTGCGGAGGACTCCACAGT GGG Intronic
900168405 1:1254293-1254315 CCTGCGCTGGCCTTCACAGTAGG - Intronic
903231867 1:21927141-21927163 CCTGGGGAGGACTTCAGAGGTGG - Intronic
903819323 1:26089375-26089397 CCTGTGGAGAACCCCACATTTGG - Intergenic
904585194 1:31576267-31576289 ACTGGGAAGGACTTCACAGTGGG - Intergenic
904754545 1:32760916-32760938 CCTGCGGAGGTGGCCCCAGTGGG + Intronic
906686284 1:47765464-47765486 CCTGCTGAGGGCCCCACAGTCGG + Exonic
909685719 1:78346356-78346378 CTTGTGGCTGACTCCACAGTAGG - Intronic
915595657 1:156895046-156895068 CCTTCGGAGGCCTCAAGAGTGGG - Intronic
922955350 1:229594695-229594717 CCTGCTGAGCGCTCCACAGCCGG + Exonic
924397097 1:243632401-243632423 TCTGAGGAGGTCTCCACAGCGGG + Intronic
1065046987 10:21753911-21753933 CATGGGGAGGCCTCCTCAGTGGG + Intergenic
1067176808 10:43955880-43955902 CCTGCAGAGGACCCCCCAGGAGG + Intergenic
1071819349 10:89264509-89264531 CCTGCTGAGGGCTGCACACTTGG - Intronic
1073878339 10:107950821-107950843 GCTGCGCAGGACCCCACAGCTGG - Intergenic
1076882957 10:133248387-133248409 CCTGGGGCGGCCTCCACAGCTGG + Intergenic
1081934675 11:46896507-46896529 TCTCCCCAGGACTCCACAGTGGG + Intronic
1084137794 11:67200094-67200116 CCTGAGCAGATCTCCACAGTGGG - Intronic
1085233046 11:74989184-74989206 CCCGAGGAGGACTCAACTGTGGG + Intronic
1092138917 12:6169317-6169339 CCTGCGGAGCACCCCAGAGAAGG - Intergenic
1102209660 12:111116653-111116675 CCTGTGGAGGACTCGACTTTTGG + Intronic
1103352079 12:120291033-120291055 TCTGCCGAGGACTCCACAGTAGG + Intergenic
1104614240 12:130255141-130255163 CCTGCGGAGGAGGCCAGAGCTGG + Intergenic
1108130003 13:47288571-47288593 CCTTTGGAGGACACCACACTAGG - Intergenic
1121068634 14:90995135-90995157 CCTGCCTTGGCCTCCACAGTAGG + Intronic
1123940206 15:25213051-25213073 CTTGGGGAGGGCTCCTCAGTGGG + Intergenic
1126773596 15:52080880-52080902 CCTGAGAAGAACTCCAAAGTGGG + Intergenic
1127262411 15:57335966-57335988 CCTGTGCAGGACTAGACAGTTGG - Intergenic
1128748509 15:70131933-70131955 CCTGCAGAGGCCTCTAAAGTTGG - Intergenic
1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG + Intronic
1134380394 16:13718972-13718994 TCTGCGGACGACTCCACAAATGG + Intergenic
1137773124 16:51034016-51034038 CCTGGGGAGGCCCCCACTGTGGG - Intergenic
1138416653 16:56875487-56875509 CCTGCCCAGGACTACACAGGTGG + Intronic
1141376488 16:83535645-83535667 CCTGTCCAGGACTGCACAGTTGG - Intronic
1147513084 17:41089180-41089202 TGTGGGCAGGACTCCACAGTGGG - Intronic
1147515153 17:41109184-41109206 TGTGGGCAGGACTCCACAGTGGG - Intergenic
1148130924 17:45262226-45262248 CCTTCGGAGGACGCCTCACTCGG - Intergenic
1149500132 17:57146374-57146396 ACTGAGAAGGGCTCCACAGTTGG - Intergenic
1149641926 17:58208401-58208423 CCTGGGGAGGATTCCAGAGTTGG - Intronic
1150548947 17:66191796-66191818 CCTGCCGGGGACACCACAGCGGG + Exonic
1150782436 17:68134342-68134364 CCTGAGCAGGGCTCCACACTTGG - Intergenic
1156479900 18:37429837-37429859 CCTACGGAAGACCCCACACTTGG + Intronic
1159778167 18:72628136-72628158 CCTGTAGAAGACTCCACACTTGG + Intronic
1161454042 19:4361436-4361458 CCTGAGCAGGACCCCACACTTGG - Exonic
1162094336 19:8301851-8301873 ACTGAGGAGGAAGCCACAGTGGG + Intronic
1162700891 19:12513830-12513852 TCTGCAGAGGACGCCACAGGTGG - Intronic
1163232394 19:16013602-16013624 CCACCGAAGGACTCCCCAGTGGG + Intergenic
1168131363 19:54321820-54321842 GCTGCCCAGGACTCCACTGTGGG - Intergenic
1168352895 19:55686641-55686663 CCTGCCTGGGACTCCAGAGTAGG + Intronic
1168693337 19:58390741-58390763 CCTGTGCAGGGCTCCACTGTTGG + Intronic
925044118 2:758381-758403 CCTGGGGATCACTCCACAGTAGG - Intergenic
925311918 2:2890859-2890881 CCTGGAGAGGGCTCCACAGGAGG + Intergenic
930095484 2:47562990-47563012 CTTGGGGAGGACTCCAGAGCTGG + Intronic
932120429 2:69094591-69094613 CCTGGGTAGGGCTCCACAGCAGG - Intronic
934056368 2:88254452-88254474 CCTGGTGAAGCCTCCACAGTGGG + Intergenic
934753499 2:96809545-96809567 CCTGCGGGGGCCTCCCCAGTGGG + Exonic
938225319 2:129610951-129610973 CTTGAGGAGGGCTCCACAGATGG - Intergenic
946122665 2:217530206-217530228 ACTGCTGAGGACTCAACAGAGGG + Intronic
946210530 2:218143842-218143864 CCTGGTGAGGGCTCCACACTGGG - Intergenic
948212633 2:236206351-236206373 CCTGAGGAGGTGTCCTCAGTTGG - Intronic
948588518 2:239035718-239035740 CCTTCGGAGGCCTCCAGAGTCGG + Intergenic
948845304 2:240680225-240680247 CCTGGGGAGGTCTCTGCAGTGGG - Intronic
948848557 2:240694654-240694676 CCTGGGGAGGTCTCTGCAGTGGG + Intronic
949000602 2:241610693-241610715 CCCGGAGAGGACTCCACGGTGGG - Intronic
1169067233 20:2701037-2701059 CCAGAGGAGGACTGCAGAGTGGG - Intronic
1172185631 20:33029443-33029465 TCTGGGGAGAATTCCACAGTTGG - Intergenic
1173339610 20:42141551-42141573 CATGCGGAAGACCCCACAGCTGG - Intronic
1174016552 20:47493232-47493254 CCTGCAAATGACTCCACAGCTGG - Intergenic
1176115274 20:63429375-63429397 CCTGTGGAGCACTCCCCACTGGG + Intronic
1177184796 21:17781434-17781456 CCAGGAGAGGACTACACAGTTGG - Intergenic
1178450924 21:32699068-32699090 TCTGCTGAGGACTCCAGAGAAGG + Intronic
1179538907 21:42071465-42071487 CCTGCCCAGGTCTCCACAGGGGG - Intronic
1179547397 21:42122035-42122057 ATTGCTGAGGACTTCACAGTTGG - Intronic
1181268394 22:21644137-21644159 CCTGCAGAGGGCTCCACACTAGG - Exonic
1183217346 22:36489628-36489650 CCTGTGAAGCACTCCACAGGCGG + Exonic
1183752779 22:39731565-39731587 CTTGTGGAGCACTCTACAGTCGG - Intergenic
949517521 3:4820978-4821000 CCTGTGGAGGCAGCCACAGTTGG + Intronic
950498021 3:13345975-13345997 CCTGCGTGGGGCTCCGCAGTCGG - Intronic
951405989 3:22297530-22297552 CCGGAGGAGGACTCTGCAGTGGG + Intronic
953571359 3:44074294-44074316 CCAGCCGAGGACTCCACAGCAGG + Intergenic
961402528 3:126657209-126657231 CCTGTGTAGGGCTCCTCAGTGGG + Intergenic
962196091 3:133364936-133364958 CCTACGGAGAACTCCAGAGCTGG + Intronic
963221397 3:142816855-142816877 CCTGCTGACGGCTCCTCAGTGGG + Intronic
975839356 4:78457217-78457239 CTTCCGGTGGACTCCACAGTGGG - Intronic
984172784 4:176380889-176380911 TCTGCGGAGGCCTCCTCACTGGG - Intergenic
985813717 5:2111051-2111073 CCTGCGGTGGAGCCCACAGCTGG + Intergenic
985923916 5:3000823-3000845 CAGGCGGAGGCCTGCACAGTGGG + Intergenic
987070836 5:14335472-14335494 GCTGCGGAGGGGTCCACAGGTGG - Intronic
991291954 5:65041926-65041948 CCTGCAAAGGGCTCCACAGAGGG + Intergenic
996205316 5:120727312-120727334 CAAGCTGAGGACTCCCCAGTTGG + Intergenic
1001300601 5:170530912-170530934 CCTGCAGAGGCCTCCATGGTAGG + Intronic
1001490572 5:172151894-172151916 TCTGCAGAGGACCCCACAGAAGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1011317953 6:86057221-86057243 CCTGGGAAGCACTCCCCAGTAGG - Intergenic
1013405645 6:109840571-109840593 CCTGTGGAGGAATATACAGTAGG + Intergenic
1013980633 6:116123519-116123541 GCTGCAGAGGATTCCACAGCTGG - Intronic
1016181774 6:141155610-141155632 CTTTCGGAAGACTCCACCGTTGG - Intergenic
1019105586 6:169664530-169664552 CTTGGGGAGGCCTGCACAGTAGG - Intronic
1023378024 7:39577684-39577706 GCTGCGCAGGAGCCCACAGTGGG - Intronic
1030101739 7:105952873-105952895 CCTGGCTAGGGCTCCACAGTGGG + Intronic
1035263129 7:157674279-157674301 CCTGTGGAGGCCTCCCCAGGAGG + Intronic
1038229750 8:25689054-25689076 CCTGGGTTGGACTCCTCAGTAGG + Intergenic
1045171073 8:99668870-99668892 CCTGCGGAACAGTCCACAGCAGG + Intronic
1049684948 8:143935581-143935603 CCTCCGGAGGCGTCCACAGAGGG + Intronic
1049751182 8:144284992-144285014 CCTGCGGAGAGCCCCACAGTGGG - Intronic
1057856525 9:98605154-98605176 CCTGTGGAGGCCTCAACAGAAGG - Intronic
1061429059 9:130519639-130519661 CCTGCAGAGCCCTCCACAGCCGG - Intergenic
1061534365 9:131238574-131238596 CCTGACGAGGACTCCAGGGTGGG + Intergenic
1061667317 9:132168219-132168241 CCTCCGGAGCACTGCCCAGTGGG - Intronic
1062003847 9:134229710-134229732 CTGGCGGGGGACTCCACAGCCGG - Intergenic
1062528285 9:136987388-136987410 CCTGCTCAGCACCCCACAGTGGG + Intergenic
1187398523 X:18939075-18939097 CCCGAGGAGGAGGCCACAGTCGG + Intronic
1191740183 X:64428021-64428043 TGTGGGCAGGACTCCACAGTTGG - Intergenic
1195016220 X:100784152-100784174 CCTGAGGAGTACTCCTCAATAGG + Intergenic
1199171594 X:144740168-144740190 TGTGGGAAGGACTCCACAGTGGG - Intergenic
1200158767 X:153993372-153993394 CCTGCCGAGGACTTCAGATTGGG + Intergenic