ID: 1132229092

View in Genome Browser
Species Human (GRCh38)
Location 15:100168743-100168765
Sequence TCCCCACTCAATGCATCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132229092 Original CRISPR TCCCCACTCAATGCATCCTC TGG Intronic
900750220 1:4390970-4390992 TCTCCGCTCACTGCAACCTCTGG - Intergenic
901828231 1:11876497-11876519 TCCCTCCTCAAAGCTTCCTCTGG - Intergenic
902727983 1:18350060-18350082 TCACCACCCACTGCTTCCTCAGG - Intronic
905410132 1:37762981-37763003 TTCCCACTCCATACATCCCCAGG + Intronic
906239847 1:44236066-44236088 TCCCCAGTCAGTGCCTCCACTGG - Intronic
907359042 1:53900044-53900066 AGGCCACTCAATGCCTCCTCAGG + Intronic
908541459 1:65126441-65126463 TCTCCACTCACTGCAAGCTCTGG - Intergenic
908596681 1:65695989-65696011 TCTCGACTCACTGCAACCTCTGG + Intergenic
911100171 1:94089352-94089374 TCCTCACTTAATTCATCCACAGG + Intronic
911201535 1:95049465-95049487 TCTCGACTCACTGCAACCTCTGG - Intronic
912284533 1:108354991-108355013 TCTCAACTCACTGCAACCTCTGG + Intergenic
912665787 1:111578287-111578309 TCCCCACACATCCCATCCTCTGG - Intronic
915102214 1:153508528-153508550 TCCCCACACCATGTGTCCTCTGG - Intergenic
916313691 1:163424440-163424462 TCCCAGCTCACTGCAACCTCTGG + Intergenic
916449716 1:164908466-164908488 TCCTCACTTCATGCATCCACAGG + Intergenic
920121554 1:203662466-203662488 TCCCCACTCCATCCAGCCTGTGG + Intronic
921279980 1:213557029-213557051 TCCTCACACAATGGATCCACAGG - Intergenic
922449883 1:225728461-225728483 TCCCCTTTCAATGCACACTCTGG - Intergenic
1063271549 10:4514930-4514952 TCCCCACGCAAGCCAGCCTCAGG + Intergenic
1063864950 10:10353760-10353782 TCCCCTCTAAATGCATGCCCAGG + Intergenic
1064662268 10:17617635-17617657 TCCCCACTAAATGCACTCGCAGG - Intergenic
1067189771 10:44059481-44059503 TCCCTAGACAGTGCATCCTCGGG + Intergenic
1068697449 10:59982767-59982789 TCCCCACTCTCTTCTTCCTCTGG - Intergenic
1069383648 10:67864857-67864879 TCCCCACCAAACGGATCCTCTGG + Intergenic
1070889407 10:79930867-79930889 TCCCCAGTGAGAGCATCCTCTGG + Intergenic
1072791003 10:98317865-98317887 TCACCAGTCAATCCCTCCTCTGG - Intergenic
1073100754 10:101005390-101005412 TCCCCACTCAGTGTCTGCTCTGG - Intronic
1074853072 10:117454291-117454313 TCCCCAGCCAGTGCAGCCTCTGG - Intergenic
1075668330 10:124246208-124246230 GCCCCACTCAGTGCATCTGCAGG - Intergenic
1076042965 10:127267127-127267149 TCCCCTCTAAAAGCAACCTCTGG - Intronic
1080539614 11:33253943-33253965 TCACAACTCACTGCAGCCTCAGG + Intergenic
1080702873 11:34659453-34659475 TCTCCACTCATTGGATCCTAAGG - Intronic
1081973965 11:47219451-47219473 TCCTGACTCAAGGAATCCTCCGG + Intronic
1082677332 11:56122225-56122247 TCCCAGCTCACTGCAACCTCTGG + Intergenic
1082734299 11:56839066-56839088 CCCCTACTCTATGCAGCCTCGGG - Intergenic
1083229383 11:61306160-61306182 TGCCCACTCACTGCACCCTCTGG + Intronic
1084765890 11:71308109-71308131 TCCCCATTCCTGGCATCCTCTGG - Intergenic
1085502318 11:77035089-77035111 TCTCGACTCAGTGCAACCTCAGG - Intronic
1085605986 11:77898950-77898972 TCTCAACTCACTGCAACCTCTGG - Intronic
1085665981 11:78416746-78416768 TCACCAGGCAAGGCATCCTCTGG + Intronic
1088575922 11:111271253-111271275 TCCCGGCTCACTGCAACCTCTGG - Intronic
1091831863 12:3555784-3555806 CCCACACTCAATGCACCCTCAGG - Intronic
1091831876 12:3555866-3555888 CCCACACTCAATGCATCCTCAGG - Intronic
1091831889 12:3555948-3555970 CCCACACTCAATGCATCCTCAGG - Intronic
1092146610 12:6219071-6219093 TCTCCGCTCATTGCAACCTCTGG + Intronic
1093148068 12:15590225-15590247 TCCAGACTAAGTGCATCCTCAGG - Intronic
1096419258 12:51442315-51442337 TACCCTCTCATTGCATCCTGGGG + Intronic
1099886034 12:88532139-88532161 TCCCCACTCACTCCACCATCAGG - Intronic
1101499548 12:105289588-105289610 TTCCCCCTCCCTGCATCCTCTGG - Intronic
1101760396 12:107653447-107653469 TCTCCACTCACTGCACGCTCTGG - Intronic
1102277380 12:111593166-111593188 TCCGCACTCATTGCAACCTCCGG + Intronic
1102556742 12:113731736-113731758 TCCCCCCTCCTAGCATCCTCTGG + Intergenic
1103101376 12:118179265-118179287 TCCCCAGTCACTGCATGCCCAGG + Intronic
1104143022 12:126006469-126006491 TCCCCACACAATTCAGCCACTGG - Intergenic
1105892190 13:24689737-24689759 TCCCCACCAAATGCATTCTGGGG - Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106980009 13:35268337-35268359 TCCCCACTCCCTGCAGCCCCTGG - Intronic
1107042139 13:35960182-35960204 TCCCCCCTTAATCCATCCTCTGG + Intronic
1107466133 13:40652351-40652373 TCTCCGCTCACTGCAACCTCTGG + Intronic
1107813156 13:44219306-44219328 TCCCAATCAAATGCATCCTCTGG - Intergenic
1108250225 13:48559334-48559356 TCTCGACTCATTGCAACCTCTGG - Intergenic
1108566755 13:51707225-51707247 TCTCAACTCACTGCAACCTCTGG + Intronic
1110076718 13:71254870-71254892 TCTCTACTCACTGCAACCTCCGG - Intergenic
1113479273 13:110608560-110608582 TCCCGGCTCATTGCAACCTCCGG + Intergenic
1114147476 14:19994065-19994087 TCCCTGCTCTATGCAGCCTCAGG - Intergenic
1114699176 14:24659873-24659895 TCTCCACTCACTACAACCTCCGG - Intergenic
1116251322 14:42485961-42485983 TCTCCACTCACTGCAAGCTCCGG - Intergenic
1117070806 14:52054073-52054095 TGGCCATTCAATGCCTCCTCTGG + Exonic
1119055127 14:71411631-71411653 CTCCCACTCATTGCAACCTCTGG - Intronic
1119923814 14:78472542-78472564 TCTCCACTTAATGCTTGCTCAGG + Intronic
1121267793 14:92615590-92615612 TGCCCTCTCTCTGCATCCTCTGG - Intronic
1122338082 14:101006963-101006985 TCTCGACTCACTGCAACCTCCGG - Intergenic
1123112432 14:105879653-105879675 TCCTCACTGAAGGCAGCCTCAGG - Intergenic
1124005290 15:25791146-25791168 TCTCGACTCACTGCAACCTCCGG + Intronic
1126626847 15:50693531-50693553 TCTCAACTCACTGCAACCTCAGG - Intergenic
1127127881 15:55830984-55831006 TCTCGGCTCAATGCAACCTCTGG + Intronic
1127703719 15:61527082-61527104 TCCCCACTCCCTGTTTCCTCTGG - Intergenic
1128128316 15:65209195-65209217 TGCCCTCTGACTGCATCCTCTGG - Intronic
1128389630 15:67174318-67174340 TCTCCACTAAATCCATCCACTGG - Intronic
1128425217 15:67536190-67536212 TCTCCGCTCACTGCAACCTCCGG - Intergenic
1128593097 15:68920079-68920101 TTCCCTCTCATTGCATCCCCTGG - Intronic
1129926385 15:79368031-79368053 TCCCCACCAAATGGATCCACTGG - Intronic
1132229092 15:100168743-100168765 TCCCCACTCAATGCATCCTCTGG + Intronic
1133967685 16:10543454-10543476 CCTCCACTCACTGCATACTCCGG - Intronic
1134396862 16:13873242-13873264 TCCCCACTCAGTGCTTTCTTAGG - Intergenic
1135128701 16:19834018-19834040 TCACCGCTCAGTGCAGCCTCGGG - Intronic
1135554299 16:23423413-23423435 TCCCCACTACATCCATCCCCAGG + Intronic
1136686759 16:31999631-31999653 TCTCCACTCACTGCAGCCTCCGG + Intergenic
1137365069 16:47853262-47853284 TCCCCACCAAATGGATCCGCTGG - Intergenic
1138341416 16:56291813-56291835 TGCCCTATCACTGCATCCTCAGG + Intronic
1138479835 16:57294931-57294953 TCCCGGCTCACTGCAACCTCCGG - Intergenic
1138704387 16:58899244-58899266 TCCCAGCTCACTGCAGCCTCGGG - Intergenic
1138887581 16:61098191-61098213 TCCCCTCCCAATCCAGCCTCTGG + Intergenic
1139588523 16:67919779-67919801 TCTCCACTCAGAGCTTCCTCTGG - Intronic
1141160771 16:81627963-81627985 TCCCCACTGGCTGCACCCTCAGG + Intronic
1141577277 16:84972110-84972132 TCTCCGCTCACTGCAACCTCTGG - Intergenic
1143235412 17:5395594-5395616 TCTCTGCTCAATGCAACCTCCGG + Intronic
1144758837 17:17695592-17695614 TCTCCGCTCACTGCAACCTCCGG + Intronic
1145125002 17:20292752-20292774 TCCCAACAAAAGGCATCCTCAGG + Intronic
1145908002 17:28526811-28526833 TCCCCTCACCATGGATCCTCAGG + Intronic
1146904734 17:36610879-36610901 TCCCAGCTCACTGCAACCTCTGG + Intergenic
1148154493 17:45414993-45415015 TCTCTACTCACTGCAACCTCTGG - Intronic
1149758613 17:59209012-59209034 TCTCGACTCACTGCAACCTCCGG - Intronic
1150208483 17:63427773-63427795 GCCCCCATCACTGCATCCTCAGG - Intergenic
1151236071 17:72720510-72720532 TCCCCACTCCCTGCCTCCCCAGG - Intronic
1154324065 18:13377064-13377086 TCCCGACTCGATGCACCTTCAGG - Intronic
1156294943 18:35781049-35781071 TCCTGACTCAAGGTATCCTCTGG + Intergenic
1156431621 18:37081046-37081068 TCTCGACTCACTGCAACCTCTGG + Intronic
1157884439 18:51352971-51352993 TACCAACTGAATGCAGCCTCAGG - Intergenic
1159095499 18:63897136-63897158 TCTGCAATCAATGCATCCACAGG + Exonic
1159804683 18:72941678-72941700 TCTCCACTCACTGCAACCTCTGG - Intergenic
1160759973 19:778856-778878 TCTCGACTCACTGCAACCTCCGG - Intergenic
1160990227 19:1857390-1857412 TCCCCACCCACCGCATCCTCAGG - Intronic
1161143914 19:2665552-2665574 TCCCCACCCAATCCTTCCTCGGG - Intronic
1161862408 19:6807920-6807942 TCTCGACTCACTGCAACCTCTGG - Intronic
1163458990 19:17425053-17425075 CCCCCCCTCACTGCATCCTGGGG + Exonic
1165264513 19:34648968-34648990 TCTCAACTCACTGCAACCTCCGG + Intronic
1165483185 19:36078213-36078235 TCTCCGCTCACTGCAACCTCAGG + Intronic
1165876141 19:39008195-39008217 TCTCCGCTCACTGCAACCTCTGG - Intronic
1166221740 19:41369412-41369434 CCTGCACTCAAGGCATCCTCCGG - Intronic
1167156365 19:47741580-47741602 TCCCCTCTAAATGCTTCCACCGG - Exonic
1167220656 19:48196298-48196320 TCCCCACTCCATCCCTCGTCCGG - Intronic
1167332520 19:48865273-48865295 TCTCGGCTCAATGCAACCTCTGG - Intronic
1167758682 19:51429399-51429421 TCCCAACACAATGCAGCCTCTGG + Intergenic
1168135559 19:54349091-54349113 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135565 19:54349121-54349143 TCCTCCCTCCATGCATCCTCAGG - Intergenic
1168135572 19:54349151-54349173 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135617 19:54349339-54349361 TCCTCCCTCCACGCATCCTCAGG - Intergenic
1168135624 19:54349369-54349391 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135646 19:54349459-54349481 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135662 19:54349523-54349545 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135669 19:54349553-54349575 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135676 19:54349583-54349605 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135691 19:54349643-54349665 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135698 19:54349673-54349695 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135704 19:54349703-54349725 TCCTCCCTCCATGCATCCTCAGG - Intergenic
1168135719 19:54349763-54349785 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135724 19:54349793-54349815 TGCTCCCTCCATGCATCCTCAGG - Intergenic
1168135739 19:54349853-54349875 TCCTCCCTCCATCCATCCTCAGG - Intergenic
1168135745 19:54349883-54349905 TCCTCCCTCCATGCATCCTCAGG - Intergenic
926183880 2:10672257-10672279 TCTCGGCTCACTGCATCCTCCGG - Intronic
927231171 2:20825506-20825528 TCCCCACTAAATGGATCCACTGG - Intergenic
928111719 2:28515772-28515794 TCCCCACCCAATGCCTGCCCAGG - Intronic
928322710 2:30296093-30296115 TCCCCAGTCAGTGAAGCCTCTGG - Intronic
928942592 2:36741794-36741816 ACCCCACTCACTGCTTCCTGGGG + Intronic
929044439 2:37776388-37776410 GCCCCACTCAAGACATTCTCTGG - Intergenic
930462224 2:51695880-51695902 TCCACACTCAGTGCTTTCTCAGG + Intergenic
930810713 2:55537301-55537323 TCCTGACTCACTGCAACCTCCGG - Intronic
931672343 2:64658952-64658974 TCTCGACTCACTGCAACCTCCGG + Intronic
932759159 2:74428299-74428321 TCCCCAGTGTCTGCATCCTCAGG + Exonic
933262069 2:80141940-80141962 TCCCCACCAAATGGATCCGCTGG + Intronic
933670982 2:85007031-85007053 TCTCGACTCACTGCAACCTCTGG - Intronic
934730443 2:96653139-96653161 TCTCAACTCACTGCAACCTCGGG - Intergenic
935297620 2:101664403-101664425 TCTCGACTCACTGCAACCTCTGG - Intergenic
936118218 2:109719472-109719494 TCCCCGCTCACTGCAACCTCTGG + Intergenic
939778312 2:146413118-146413140 TTCCCACTCTATCCATCTTCTGG - Intergenic
939825425 2:147009690-147009712 TCTCAACTCACTGCAACCTCCGG + Intergenic
940237677 2:151528520-151528542 TCTGCCCTCAATCCATCCTCAGG + Intronic
940666478 2:156616906-156616928 GGGCCACTCAATTCATCCTCAGG + Intergenic
941346213 2:164372407-164372429 TCCCTGCTCTATGCAGCCTCAGG + Intergenic
942219029 2:173751193-173751215 TCCAGACTTAATGCATCCACAGG - Intergenic
945975932 2:216270768-216270790 TCCCCACTCAAGCCACACTCTGG + Intronic
948830742 2:240597194-240597216 TCCCCACTCACCACCTCCTCTGG - Intronic
1172882391 20:38210576-38210598 TCTCCCCTCACTGCATCCCCTGG - Exonic
1174443328 20:50573545-50573567 GACCCACTCAATACCTCCTCTGG - Intronic
1174738037 20:52984264-52984286 TCCGCACTCAATGTAAGCTCCGG - Intronic
1175579577 20:60088195-60088217 TCCCCTCTCTAGGCATACTCAGG - Intergenic
1176901600 21:14448934-14448956 TCCCCATTCAATGTACCCACAGG + Intergenic
1177048894 21:16206148-16206170 CCTCCACTCACTGCAACCTCCGG - Intergenic
1177734615 21:25073075-25073097 TCACTACTCTATGCACCCTCAGG - Intergenic
1179573245 21:42290889-42290911 TCTCCACTCAATGACTCTTCAGG + Intronic
1179941683 21:44643249-44643271 TCCCCACTCCCTGCACCCCCTGG - Intronic
1179981637 21:44899028-44899050 CCCCCACCCAATGGATGCTCGGG + Intronic
1180066540 21:45415361-45415383 TCCTGACTCAATGGAACCTCTGG + Intronic
1184104438 22:42359349-42359371 TCCCCACTCCATCCCTCCCCTGG - Intergenic
1184408404 22:44313070-44313092 TCCCCACGCACTCCAGCCTCTGG + Intergenic
1185355379 22:50366376-50366398 TCCCAGCTCACTGCAGCCTCCGG + Intronic
950099917 3:10350368-10350390 TCCCAACGTAAAGCATCCTCAGG - Intronic
950660013 3:14461430-14461452 GCCCTACTTACTGCATCCTCAGG - Intronic
952131585 3:30370328-30370350 TCCCCTCTCTATTCTTCCTCAGG - Intergenic
953092833 3:39746724-39746746 TCCCCACCAAATGGATCCACTGG - Intergenic
953951066 3:47190621-47190643 TCTCGACTCACTGCAACCTCTGG + Intergenic
955006374 3:54972646-54972668 TCCCCAGTCAATGCACTCTCTGG + Intronic
957300885 3:78390159-78390181 CCCCTACTCTATGCAGCCTCGGG + Intergenic
957827571 3:85468701-85468723 TCCCCACTTAATGTATCCCACGG - Intronic
959942895 3:112097854-112097876 TCCTCTCTCTAAGCATCCTCAGG + Intronic
960072470 3:113446626-113446648 TCTCCACTAAATGCCACCTCAGG - Exonic
961422726 3:126819050-126819072 TCCCCACCCCATGCATTCTATGG + Intronic
964856473 3:161151143-161151165 CCCCCACTGAATGGATCCTCTGG - Intronic
966702192 3:182866996-182867018 TCTCAGCTCAATGCAGCCTCTGG + Intronic
967264295 3:187676495-187676517 TCTCAACTCACTGCAGCCTCTGG - Intergenic
968843233 4:3023690-3023712 TCCCCACCCAAAGCCACCTCTGG - Intronic
968892895 4:3380747-3380769 TCCCTGCTCTATGCAACCTCAGG - Intronic
969470904 4:7388808-7388830 TCACCACTCAAGGCAGCCCCGGG - Intronic
969501800 4:7558047-7558069 TCCTCACTCAACACCTCCTCCGG - Intronic
969618734 4:8268446-8268468 TCCCTACTCAACGCCTCCCCAGG + Intergenic
973803584 4:54502223-54502245 TTCCCACAAAAGGCATCCTCTGG - Intergenic
975802211 4:78072560-78072582 TCCCCGCTGAGTGCATCCTCAGG - Intronic
978981364 4:114950207-114950229 TCCCAACACAAAGCTTCCTCTGG + Intronic
979966858 4:127086475-127086497 CCCCAACTCTATGCAGCCTCGGG + Intergenic
982721925 4:158868566-158868588 TCCCCACAAAATGCATTCTGAGG - Exonic
983628238 4:169824954-169824976 TCTCGACTCAGTGCAACCTCTGG + Intergenic
985619752 5:948029-948051 CGCCCTCTCAATCCATCCTCAGG - Intergenic
987457582 5:18165855-18165877 TCCCTGCTCTATGCAGCCTCAGG - Intergenic
988436818 5:31185572-31185594 TCCACACTCTTTGCATCCTCTGG - Intergenic
988586297 5:32510513-32510535 TCCTGGCTCACTGCATCCTCTGG + Intergenic
990787528 5:59439290-59439312 TCTTCACTCACTGCAACCTCTGG - Intronic
992965450 5:81995196-81995218 TCTCGACTCACTGCAACCTCCGG + Intronic
994612947 5:102068695-102068717 TCTCCACCCAATGCCTGCTCTGG - Intergenic
995434371 5:112119349-112119371 TCCTCACTCAGTGCTTACTCTGG - Intergenic
995717134 5:115091430-115091452 TCACCACTCACTGCTGCCTCAGG + Intergenic
1001338403 5:170821043-170821065 TCTCAACTCACTGCAACCTCTGG - Intergenic
1004225290 6:13779270-13779292 TCCCCACCGAATGGATCCACTGG - Intergenic
1004375314 6:15085954-15085976 TCTCAGCTCAATGCAACCTCTGG - Intergenic
1006014855 6:31072342-31072364 TCCCCACTCAATCCAGCTTGCGG - Intergenic
1006106998 6:31722785-31722807 TCTCGACTCACTGCAGCCTCCGG - Intronic
1007354614 6:41304399-41304421 TCCCCACTCAGTTCATAATCTGG - Intergenic
1008394271 6:50988845-50988867 TCTCAACTCAATGCAATCTCTGG - Intergenic
1009554791 6:65148966-65148988 TCCCCACTCCGTGCAGCCTCAGG - Intronic
1011482800 6:87811953-87811975 TCCCCACCCAATGGATCCACTGG + Intergenic
1011868612 6:91862833-91862855 ACCCCATTCAAGGCAGCCTCAGG - Intergenic
1011933022 6:92737828-92737850 TCCCTGCTCTATGCACCCTCAGG + Intergenic
1012179907 6:96139819-96139841 GCCCCACTCTATGCAGCCTCAGG - Intronic
1014989221 6:128053299-128053321 TCCTCACTCCATGCAGACTCAGG + Intronic
1017309464 6:152958886-152958908 TCCCGGCTCACTGCAACCTCTGG - Intergenic
1017678921 6:156843925-156843947 TCCCCACCCCATGCAGCTTCAGG - Intronic
1018348486 6:162928769-162928791 TCCCCACTCTTTCCAACCTCTGG + Intronic
1019441143 7:1047713-1047735 GCCCCAGGCACTGCATCCTCAGG - Intronic
1019971874 7:4548066-4548088 TCTCCACTCACTGCAACCTTTGG + Intergenic
1020253229 7:6485664-6485686 TCTCCGCTCAATGCAACCTTTGG - Intergenic
1021082090 7:16376768-16376790 TCTCCATGCAATGCTTCCTCAGG + Intronic
1021846928 7:24772107-24772129 TCCCAAGTCCTTGCATCCTCTGG + Intergenic
1022215153 7:28252469-28252491 TTCCCACTGAATCCATCCTCAGG + Intergenic
1023504855 7:40888828-40888850 TCCCCTTCCAATGCATACTCGGG - Intergenic
1025896868 7:65710985-65711007 TCTCAACTCACTGCAACCTCTGG + Intergenic
1026187391 7:68092512-68092534 TCCCCACCCAAGGCAGCCTCAGG + Intergenic
1027624226 7:80528004-80528026 TCTCCACTCTATGCAGCCTGGGG - Intronic
1032012513 7:128356182-128356204 TCTCAGCTCACTGCATCCTCCGG - Intronic
1032985183 7:137329801-137329823 TCCATACTCAATGCATATTCAGG + Intronic
1034430086 7:151036779-151036801 TCCCCACCCTATGCATCCCTGGG - Intronic
1034607551 7:152331240-152331262 TCCCAGCTCACTGCAGCCTCTGG - Intronic
1035585873 8:773156-773178 TCCCCAGTCAATGCGTCAGCAGG + Intergenic
1038227073 8:25667386-25667408 CCCCCACTAAATGAATCCCCTGG - Intergenic
1041368344 8:57132640-57132662 TCTCGGCTCAATGCAACCTCTGG + Intergenic
1042197037 8:66239626-66239648 TCCCCACTCTGTGCAGCCACTGG + Intergenic
1042577111 8:70232684-70232706 TCTCTACTTAATGCATACTCAGG + Intronic
1044517146 8:93152864-93152886 TCACCACTCAAAGATTCCTCAGG + Intronic
1046178533 8:110611296-110611318 TCTCGACTCACTGCAACCTCGGG + Intergenic
1050773639 9:9234324-9234346 CGCCCACTCTATGCATCCTCAGG - Intronic
1051394291 9:16602572-16602594 TCCCCACTCTATGCCCACTCAGG + Intronic
1051694568 9:19754226-19754248 GCCCCACTCATTGCCTCCCCAGG + Intronic
1052344030 9:27390315-27390337 TCTCCGCTCACTGCCTCCTCTGG + Intronic
1053170740 9:35880378-35880400 TCTCGACTCACTGCAACCTCCGG + Intergenic
1056541212 9:87572902-87572924 TCACCACCCAATGCATTCTGTGG - Intronic
1056927192 9:90845001-90845023 TCTCAGCTCAATGCAACCTCTGG + Intronic
1057491743 9:95525581-95525603 TCCCCACTTCATGCAGTCTCAGG - Intergenic
1058269886 9:102958580-102958602 TCTCAACTCACTGCAACCTCCGG + Intergenic
1059653364 9:116335184-116335206 TCCCTTCTCCATCCATCCTCTGG + Intronic
1060587230 9:124794163-124794185 TCCCCACTCCAGAGATCCTCTGG - Intronic
1061495910 9:130974070-130974092 GCCCCACTTACTGCCTCCTCCGG - Intergenic
1061843630 9:133375304-133375326 TCCCCACTCAATCCAGCCCAGGG + Intronic
1062192645 9:135255785-135255807 TCCCCACCCCATGCCTCGTCTGG + Intergenic
1062383904 9:136300941-136300963 GCCCCACTGGATGCATTCTCAGG - Intronic
1186130564 X:6461236-6461258 CCCCCACAAAATGCATCCACTGG + Intergenic
1186679342 X:11855216-11855238 TCCCTGCTCTATGCAGCCTCAGG - Intergenic
1187300473 X:18044318-18044340 TCCCCAGTCATTGCAGCCTGAGG - Intergenic
1187343813 X:18445143-18445165 TCTCAGCTCACTGCATCCTCTGG + Intronic
1187993966 X:24905628-24905650 TCTCCACTTACTGCAACCTCCGG + Intronic
1188194847 X:27220957-27220979 TCCCCTCTAAATGCATCAGCAGG - Intergenic
1189232979 X:39466417-39466439 CCCCCACTCACTGCTTCCTAGGG + Intergenic
1190192366 X:48288180-48288202 TCTCCGCTCACTGCAGCCTCCGG + Intergenic
1192409130 X:70916932-70916954 TCCCCACTCCCTCCAGCCTCTGG + Intergenic
1192471207 X:71400155-71400177 TCTCCACTTACTGCAACCTCCGG + Intronic
1196314764 X:114209968-114209990 CCCCCACCAAATGGATCCTCTGG + Intergenic
1197485745 X:127049368-127049390 TCTCCACTCACTGCAACCCCTGG + Intergenic
1197536149 X:127691289-127691311 TCCCTACTCTATGCAGCCTTGGG + Intergenic