ID: 1132236402

View in Genome Browser
Species Human (GRCh38)
Location 15:100225118-100225140
Sequence GCTGCATGTTTTGCTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132236402_1132236405 18 Left 1132236402 15:100225118-100225140 CCAGTTGCAGCAAAACATGCAGC 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1132236405 15:100225159-100225181 GGAAACATACTTAACCATCTTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1132236402_1132236403 -3 Left 1132236402 15:100225118-100225140 CCAGTTGCAGCAAAACATGCAGC 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1132236403 15:100225138-100225160 AGCTGCTATTGCTCCAAGATTGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132236402 Original CRISPR GCTGCATGTTTTGCTGCAAC TGG (reversed) Intronic
901031680 1:6310676-6310698 CCTGGAGGTTTTGCTGCAGCAGG - Intronic
906819065 1:48910493-48910515 CCTGCATATTTTTCTGCATCTGG - Intronic
907896653 1:58699201-58699223 GCTGTTTGTTCTGCTGGAACAGG + Intronic
908690249 1:66771521-66771543 GCTTTATGTTCTTCTGCAACAGG - Intronic
910697426 1:90035415-90035437 GTTCCAAGTTTTGCTGCAAATGG - Intronic
911443739 1:97964229-97964251 GTTTCTTGGTTTGCTGCAACTGG + Intergenic
917628546 1:176870667-176870689 GCTGCAAGTTTGGTTGCTACAGG - Intronic
918924693 1:190767031-190767053 GTTGCATGTTTTGGTGAAAAAGG - Intergenic
1067276426 10:44838919-44838941 GCAGCATGTTTTCCTGCACAGGG - Intergenic
1073567971 10:104551806-104551828 GCACCATGTTTCGCTGCACCTGG + Intergenic
1076531825 10:131150018-131150040 TCATGATGTTTTGCTGCAACTGG + Intronic
1076818166 10:132924751-132924773 GCCGCAGGTTGTGCTGCAGCAGG + Exonic
1080179517 11:29407102-29407124 GCTGTGTGTTTCACTGCAACAGG - Intergenic
1081631825 11:44694508-44694530 GCAGCATGTTCTGCTGCACTAGG + Intergenic
1083238431 11:61367745-61367767 GCTCCATTTTTCGCTGCAAAGGG - Intronic
1084492377 11:69485894-69485916 GCTGCATCCTTAGCTGCAGCAGG + Intergenic
1089284269 11:117395600-117395622 GCTGCTGGTTTGACTGCAACAGG - Exonic
1089518114 11:119046521-119046543 GCTGCATGTTCTGCTGGACAGGG - Intronic
1090386085 11:126358216-126358238 GCTGGACGTTTCCCTGCAACAGG + Intronic
1091566854 12:1655242-1655264 ACTGCATGTCGTGCTGGAACAGG + Intergenic
1093430596 12:19080824-19080846 GCTGCATGTTTGGCTTCTAAAGG + Intergenic
1098860553 12:75705124-75705146 TCTGCATGTTTTCAGGCAACGGG + Intergenic
1100959393 12:99945763-99945785 GCTTCATTTCTTCCTGCAACAGG - Intronic
1101060417 12:100965431-100965453 GCTGCATGTTTTGCAGAGAATGG - Intronic
1101571013 12:105953822-105953844 GCTGCAACTTGTTCTGCAACAGG + Intergenic
1108329143 13:49367460-49367482 GCTGCATGTTTAGCTGTTTCAGG - Intronic
1109457688 13:62614008-62614030 GCTGCATGCTTTTCTGCACTTGG + Intergenic
1111911019 13:94311981-94312003 GCTCCAGGTTTTCCTGCAGCTGG + Intronic
1113268724 13:108648845-108648867 GCTTCATGTATTGCTGGATCAGG + Intronic
1116603396 14:46957719-46957741 GCTGCATGTGTTACTGCAAATGG - Intronic
1120076216 14:80161416-80161438 GCTGGGTGTTCTTCTGCAACTGG + Intergenic
1121410901 14:93747449-93747471 GGTTCAAGTTTTGCTGCAAAAGG + Intronic
1127035671 15:54914526-54914548 GATGTTTGTTTTTCTGCAACTGG - Intergenic
1128831979 15:70777801-70777823 TCTTCAAGTTTTGCTGCGACGGG + Intergenic
1131419155 15:92289270-92289292 GCTCCTTCTTTTGCTGCACCTGG - Intergenic
1132236402 15:100225118-100225140 GCTGCATGTTTTGCTGCAACTGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134223257 16:12371717-12371739 GCTGCAAGCTTTGCTCTAACAGG - Intronic
1136156736 16:28388078-28388100 GCTGAATGTTGTCCTGCAAGTGG + Exonic
1136206350 16:28727203-28727225 GCTGAATGTTGTCCTGCAAGTGG - Exonic
1141616192 16:85211029-85211051 GTTGCAGGTTTTGCTGATACTGG + Intergenic
1203125381 16_KI270728v1_random:1573261-1573283 GCTGCATGTTCTGATTCAGCAGG - Intergenic
1144661546 17:17073891-17073913 GAGGCTTGCTTTGCTGCAACAGG - Intronic
1147524843 17:41212800-41212822 GCAGGATGTGTTGCAGCAACTGG - Intronic
1147528967 17:41255606-41255628 GCAGCAGGTTGTGCTGCAGCAGG - Exonic
1151523019 17:74644587-74644609 GCTTTATGTCTTGCTGAAACTGG - Intergenic
1153112935 18:1614943-1614965 GCTGTATGATTTGCTGCATATGG - Intergenic
1158211587 18:55056334-55056356 TCTGCATGGTTTGCTTCAAAGGG - Intergenic
1159503211 18:69300226-69300248 CCTTCACGTTTTCCTGCAACTGG - Intergenic
1159697361 18:71576570-71576592 ACTGTATCTTTTGCTGGAACTGG + Intergenic
1160037221 18:75312748-75312770 GCTGCATGTTTTCCTAAACCTGG + Intergenic
1161405251 19:4087990-4088012 GCTGCATGTTTTACAGGAAAGGG + Intergenic
930306177 2:49677581-49677603 CCTGCATGCTTTGATGAAACTGG - Intergenic
933245309 2:79968458-79968480 GTTGCATGTTTTGCTCCATATGG - Intronic
933245518 2:79970536-79970558 GCTGCATGTTTTGCTCCGTATGG + Intronic
933606427 2:84389242-84389264 GCTCCATGTGAGGCTGCAACTGG + Intergenic
935743382 2:106170357-106170379 GCTGCATGTTTTGTTCTAATTGG + Intronic
936749254 2:115621120-115621142 TCTGCATGTTTTTCTGCATTTGG - Intronic
941644723 2:168027717-168027739 ACTGCAGGTTCTTCTGCAACTGG + Intronic
942726807 2:179018283-179018305 CCTGCATGTTTTCCTGACACTGG + Intronic
943367413 2:186979554-186979576 TCTACATGTTCTGCTGCCACGGG + Intergenic
943447811 2:188010736-188010758 GGTGCATGTACTGCTGCTACAGG + Intergenic
948350508 2:237336248-237336270 GCTGCTGGCTTTGCTGCTACAGG + Exonic
1169871607 20:10254136-10254158 TCTGCATGTTTTGCTGCTAAAGG + Intronic
1173077785 20:39836267-39836289 GCTGCATGTGCTGCTGTAAAAGG + Intergenic
1173374678 20:42472618-42472640 GGTACATGTTCTGCTACAACAGG + Intronic
1173913959 20:46692834-46692856 GCTGCATATTTTGCAGCCAGAGG - Intergenic
1174281653 20:49444250-49444272 CTTGCATGTTCTGCTGCAGCTGG - Intronic
1175312765 20:58023515-58023537 GCTGCCTGTCTTGCAGCAGCTGG - Intergenic
1181667006 22:24405318-24405340 GCTCCATGTGTTGCTGCACATGG - Intronic
1182034621 22:27188129-27188151 ACTGGAGGTTTTCCTGCAACGGG + Intergenic
1183387465 22:37523326-37523348 GGTGCTTGCTTTGCTGCACCAGG + Intergenic
1184882856 22:47322399-47322421 GCTGCTTGTTATGCAGCAATAGG - Intergenic
1185341753 22:50294122-50294144 GCTGCCTGTGTTCCTGGAACAGG + Intronic
952093623 3:29921899-29921921 CCTGGATGTTTTGCTTCAGCAGG - Intronic
961155763 3:124678168-124678190 GGTGCATTTTTTGGTACAACAGG + Intronic
963417909 3:145022572-145022594 AGTGCCTGTTTTGCTGTAACAGG + Intergenic
967204472 3:187107049-187107071 TCTGCATGCTTTGTTGCAAATGG - Intergenic
969398952 4:6940840-6940862 GCTGCATGGACTGCTGTAACAGG - Intronic
969450357 4:7269331-7269353 GCCGCATGTCATGGTGCAACCGG - Intronic
969910888 4:10444779-10444801 GCTGTTTGTTTTGCTGAAAGTGG - Exonic
971080234 4:23201531-23201553 GCTTCCTGTTTTGGTGCAATGGG + Intergenic
972736006 4:41842189-41842211 GCTCCCTTTTTTGCTGCATCAGG + Intergenic
973870459 4:55160967-55160989 GCTTCAGGTGTGGCTGCAACCGG + Intergenic
974644107 4:64670916-64670938 GCTGCCTGTCCTGCTGCAGCTGG - Intergenic
978822164 4:112979247-112979269 GCTGCCTGCCTTGCTGCAGCCGG - Intronic
979295757 4:119031047-119031069 ACTGCAGGTTTTGGAGCAACAGG - Exonic
981588877 4:146334656-146334678 GCTGCCTCTTTAGTTGCAACAGG - Intronic
983782297 4:171685216-171685238 GATGCAACTTCTGCTGCAACTGG + Intergenic
983783646 4:171704602-171704624 GCTCCATGTTTTGCCCCAAAGGG + Intergenic
985810347 5:2078686-2078708 TCTGCAGGCTTTGCTGCATCAGG + Intergenic
986735065 5:10662306-10662328 GCTGCATCTGGTCCTGCAACAGG + Intergenic
990931672 5:61098394-61098416 GCTGGATGCTTTGCAGCAATGGG - Intronic
994846059 5:104989814-104989836 GCTGTGTGATTTGCTGAAACAGG + Intergenic
996176896 5:120369468-120369490 GCTGCCTGCTCTGCTGCAGCTGG + Intergenic
1000359470 5:160433814-160433836 GCTGCATGTTTTCAAGCAACAGG + Intergenic
1001712668 5:173790912-173790934 TCTTCATGTTTTCCTGCACCGGG + Intergenic
1007760991 6:44133688-44133710 GCTGCCTGGTTGCCTGCAACTGG - Intronic
1007925142 6:45644213-45644235 GGTGCAAGTCATGCTGCAACTGG - Intronic
1012389097 6:98716699-98716721 GTAGCATGTTTGGCTGCCACAGG - Intergenic
1014303324 6:119710898-119710920 GGTGCTTGTGTTGCTGCTACAGG - Intergenic
1014391449 6:120871378-120871400 GCTGCATGCTCTGCAGAAACGGG + Intergenic
1017677652 6:156830288-156830310 GCTGCACGTTTTACTGCCCCAGG + Intronic
1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG + Intergenic
1021423194 7:20468636-20468658 GCTGCATTTCTTGCTGCAAATGG - Intergenic
1024790133 7:52956602-52956624 ACTGCTTGTTTTTCTGTAACCGG + Intergenic
1025252851 7:57363452-57363474 GCTGGGTGTTTTGCTGCGGCTGG + Intergenic
1030051123 7:105538501-105538523 GCTGCATGACTTCCTCCAACTGG - Intronic
1030614879 7:111728831-111728853 GCTGCATCTCCTGCTGCAGCCGG - Intronic
1032748634 7:134813797-134813819 GCTGCGTGTTTTCCTCCAGCTGG + Intronic
1037019721 8:13955196-13955218 GCTGCATGTTTGGGTGGACCAGG + Intergenic
1041731936 8:61071173-61071195 ACTGCATGTTTTGCTACAAATGG + Intronic
1045300626 8:100907534-100907556 GCTGCATGTGAGGCTGCAGCTGG + Intergenic
1051744928 9:20286561-20286583 GCTCTATGTTATGCTGCAAGGGG + Intergenic
1052809587 9:33045401-33045423 GCTGCAGGTTTTGTGGCAAATGG + Exonic
1054820890 9:69519372-69519394 GCAGCAAGTGTTGCTGCTACGGG + Intronic
1056759201 9:89403145-89403167 GGGCCATGTGTTGCTGCAACAGG + Intronic
1059319599 9:113458329-113458351 GCTGCCTGTTTTTGTACAACAGG - Intronic
1059349277 9:113652984-113653006 GCAGCATGTTTTGGAGCAACTGG + Intergenic
1060437462 9:123606525-123606547 ACTGCATGTTTTACTACAAAAGG + Intronic
1062423700 9:136496511-136496533 GCTGCAGGCTTTGCTGCTGCTGG + Exonic
1185781885 X:2854971-2854993 TCTGCGTGTTTTGCTTCACCAGG + Exonic
1189128951 X:38478741-38478763 GTTGCCTGTTTTACTGAAACTGG + Intronic
1197433913 X:126401137-126401159 GCTGCACGTTTTGCTGCCAAGGG - Intergenic