ID: 1132236713

View in Genome Browser
Species Human (GRCh38)
Location 15:100227562-100227584
Sequence TCCAGCGATGTGCCATCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132236713_1132236718 15 Left 1132236713 15:100227562-100227584 CCCAGTGATGGCACATCGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1132236718 15:100227600-100227622 TCCTCCTGGCCTTTCCCTCATGG 0: 1
1: 1
2: 7
3: 56
4: 394
1132236713_1132236716 -8 Left 1132236713 15:100227562-100227584 CCCAGTGATGGCACATCGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1132236716 15:100227577-100227599 TCGCTGGATGGACAGATCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 176
1132236713_1132236717 1 Left 1132236713 15:100227562-100227584 CCCAGTGATGGCACATCGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1132236717 15:100227586-100227608 GGACAGATCTGTGGTCCTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132236713 Original CRISPR TCCAGCGATGTGCCATCACT GGG (reversed) Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900762468 1:4482377-4482399 TTCAGTGATGTGCCACCTCTGGG + Intergenic
905590761 1:39161259-39161281 TCCAGACCTGTGCCATGACTGGG + Intronic
906909829 1:49935960-49935982 TCCAGCGTTGTTCCATTGCTGGG - Intronic
908489832 1:64632468-64632490 TCCATCCTTGTGCCATCCCTGGG + Intronic
908502890 1:64761972-64761994 TACAGGCATGTGCCACCACTAGG - Intronic
911114496 1:94232674-94232696 TCCAGCTATGTGCCAGTATTAGG - Intronic
914908820 1:151768511-151768533 TCCAGTGATGTGCAATCTCTTGG + Intronic
918705772 1:187660181-187660203 TCCAGTGATGGGCGATCACATGG + Intergenic
1071828992 10:89353409-89353431 TGCAGGGATCTGCCAGCACTTGG - Intronic
1079491234 11:20991123-20991145 TAGAGCCATGTGCCATCACAAGG + Intronic
1084862060 11:72025480-72025502 TCCAGCGAAGTTCCCCCACTAGG - Intronic
1088573511 11:111247117-111247139 TCCTGCCATGTGCCACAACTTGG - Intergenic
1089211043 11:116802779-116802801 TCCTGCGATGTGTCCTCATTTGG - Intergenic
1089281451 11:117377488-117377510 TCCAGCTGTCTGCCATCTCTGGG + Intronic
1099625870 12:85072944-85072966 TGCAGGGTTCTGCCATCACTTGG + Exonic
1101693077 12:107098619-107098641 TACAGAGCTGTGCCTTCACTTGG + Intergenic
1103336808 12:120195787-120195809 TACAGGCATGTGCCACCACTCGG - Intergenic
1108523470 13:51265125-51265147 TCCAGCTGTGTGCCATCCTTAGG - Intronic
1112954328 13:105040381-105040403 CCCTGCAATGTGCCATCAGTGGG - Intergenic
1114049716 14:18913185-18913207 TCCTGCTATGTGCCAGCTCTGGG + Intergenic
1115269495 14:31536164-31536186 TACAGGCATGTGCCGTCACTGGG + Intronic
1119078633 14:71671135-71671157 TCCAGAGATGTGCCTTCCTTTGG + Exonic
1123724915 15:23092168-23092190 TCAATTGATGTGCCATCTCTGGG + Intergenic
1124338244 15:28873253-28873275 TGCAGCCATGTGCCTTCAGTGGG + Intergenic
1126706407 15:51409958-51409980 TGCAGAGAAGTTCCATCACTCGG + Intergenic
1128512044 15:68319343-68319365 TCCAGCGCTGTGCTAGCACTTGG - Intronic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1129758555 15:78113283-78113305 TACAAGGATGTGCCATGACTTGG + Intronic
1131430605 15:92385326-92385348 TCAAGCTATCTGACATCACTGGG - Intergenic
1132236713 15:100227562-100227584 TCCAGCGATGTGCCATCACTGGG - Intronic
1133395357 16:5442683-5442705 CCCTGCTATGTGCCATCACCTGG + Intergenic
1134227079 16:12399578-12399600 TCCAGCCATTTGACCTCACTGGG + Intronic
1136753524 16:32664517-32664539 TCCACCCTTGTGCCTTCACTGGG + Intergenic
1136814589 16:33205848-33205870 TCCACCCTTGTGCCTTCACTGGG - Intronic
1136821065 16:33315928-33315950 TCCACCCTTGTGCCTTCACTGGG - Intergenic
1136827628 16:33372467-33372489 TCCACCCTTGTGCCTTCACTGGG - Intergenic
1136832694 16:33471238-33471260 TCCACCCTTGTGCCTTCACTGGG - Intergenic
1137709865 16:50559082-50559104 ATCAGAGATGAGCCATCACTTGG - Intronic
1138802084 16:60045494-60045516 TTCAGCGATGGGCCATCAGTTGG + Intergenic
1140774463 16:78237494-78237516 TCCAGCCAAGTGCTTTCACTTGG + Intronic
1202993165 16_KI270728v1_random:28822-28844 TCCACCCTTGTGCCTTCACTGGG - Intergenic
1148458335 17:47822883-47822905 CCCAGGGATGTTCAATCACTGGG - Intergenic
1149643997 17:58226069-58226091 TCCAGTGATGTGTCAAGACTTGG + Intronic
1156595376 18:38542492-38542514 TCCAGCCTTGAGCCATCAATAGG + Intergenic
1159167683 18:64723849-64723871 TCCAGATATATGCCAACACTTGG + Intergenic
1164464044 19:28472438-28472460 ACCAGAGAAGTGCCATCACAGGG + Intergenic
1165531319 19:36404248-36404270 TCCTGCCATGTGCCATGACTAGG - Intronic
1166916887 19:46201583-46201605 GCGGGCCATGTGCCATCACTGGG - Intergenic
1167326926 19:48832441-48832463 CCCAGGGCTGTGCCCTCACTTGG - Intronic
926226973 2:10973675-10973697 TCCAGCAATGAGCCACGACTGGG - Intergenic
929287390 2:40150563-40150585 GCAAACAATGTGCCATCACTGGG - Intronic
941421465 2:165287293-165287315 TGCAGTGATCTGCCAGCACTTGG + Intronic
942091065 2:172491847-172491869 CCAAGGGATGGGCCATCACTGGG - Intronic
942811322 2:180004342-180004364 TTCAACAATGTGCAATCACTGGG + Intronic
946572747 2:221042626-221042648 TCCAGCGATTTGGCCCCACTGGG + Intergenic
948499234 2:238379476-238379498 GGCAGCGTGGTGCCATCACTTGG + Intronic
1173877783 20:46386281-46386303 TCAATTGATGTGCCATCTCTGGG - Intronic
1179400186 21:41076209-41076231 GCCAGCGCTGTGCCAGCACCTGG + Intergenic
1182497399 22:30719363-30719385 TGCAGAGATGTGCCATGAATGGG + Intronic
952344434 3:32470711-32470733 CCCAGTGATGTGGCATCAGTGGG + Intronic
953261243 3:41341062-41341084 TCCAGCTGTGTGCCATCTCACGG + Intronic
958557083 3:95693025-95693047 TCCAGTGCTGTGCTAGCACTGGG + Intergenic
960087907 3:113610509-113610531 TCTAGCTATTTTCCATCACTAGG + Intronic
961404177 3:126667169-126667191 ACCAGCGGGGTGCCAGCACTGGG - Intergenic
1003724958 6:8750767-8750789 TCCAGCCATCTGCCATCATGGGG - Intergenic
1004034368 6:11908596-11908618 GCCAGGGATATCCCATCACTGGG - Intergenic
1004501283 6:16212466-16212488 TCCAGCGATCTTCCAGCACTTGG + Intergenic
1005397747 6:25400708-25400730 GCCAGCTGTGTGACATCACTTGG - Intronic
1026970228 7:74463197-74463219 CCCAGAGATGTGACATCACTCGG - Intronic
1033345722 7:140524217-140524239 TTCAGCAATGTGGCAACACTTGG + Intronic
1033470357 7:141641553-141641575 CCAAGCAATGTGCCATCAATGGG + Intronic
1035294832 7:157861149-157861171 TCCAGGGATGTGCCAGCTCAGGG + Intronic
1036132334 8:6127318-6127340 TCTAGTGATGTGGCATGACTTGG + Intergenic
1036754281 8:11462036-11462058 TGCAGCGCTGTGCCTGCACTGGG + Intronic
1048371120 8:133777006-133777028 TCCAGCTCTGTGCCGTTACTAGG - Intergenic
1050754211 9:8980064-8980086 TCCTGCCATTTGCCATAACTTGG + Intronic
1055689595 9:78815508-78815530 TCCAGTGATGTGGCATTTCTGGG - Intergenic
1061202775 9:129147115-129147137 GGCAGCCAGGTGCCATCACTTGG - Intronic
1061758989 9:132836756-132836778 TCACGCCATTTGCCATCACTTGG + Intronic
1185783338 X:2867859-2867881 TCAAGTGATCTGCCAACACTTGG - Intronic
1192173851 X:68873889-68873911 CTCAGTGATGTGACATCACTGGG + Intergenic
1197667049 X:129235395-129235417 TCCAGGGATTTTTCATCACTGGG - Intergenic
1197907612 X:131442990-131443012 TTCAGAGATGGGCCATCACCAGG - Intergenic