ID: 1132236875

View in Genome Browser
Species Human (GRCh38)
Location 15:100228778-100228800
Sequence CTGTCCAATGGTCTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132236865_1132236875 16 Left 1132236865 15:100228739-100228761 CCACAGCAATGCTCTGCCTGGCA 0: 1
1: 0
2: 2
3: 23
4: 247
Right 1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 229
1132236869_1132236875 0 Left 1132236869 15:100228755-100228777 CCTGGCAAGGGCAGGTGACTTGT 0: 1
1: 0
2: 0
3: 19
4: 163
Right 1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132236875 Original CRISPR CTGTCCAATGGTCTGGGGGA AGG Intronic
901634395 1:10663850-10663872 CTCTCCACTCCTCTGGGGGAAGG + Intronic
902599494 1:17531446-17531468 AGGTCACATGGTCTGGGGGAAGG + Intergenic
903181769 1:21608493-21608515 CTGTGGAGTGGCCTGGGGGAAGG - Intronic
905750921 1:40463096-40463118 CAGTCCAATGCTCTGGCTGAAGG - Exonic
906370439 1:45248591-45248613 GGGTCTAATGGTCTGAGGGATGG + Intronic
909198628 1:72659412-72659434 CTGTCCAAGGGATTGGGGGTGGG - Intergenic
912175183 1:107146301-107146323 CTTTCCAAAGGGCCGGGGGATGG - Intronic
912454488 1:109788512-109788534 CCTTCCAATTGCCTGGGGGAGGG + Intergenic
912851868 1:113133290-113133312 CTGGCCAATGCTCTCAGGGATGG - Intergenic
912851934 1:113134194-113134216 CTGGCCAATGCTCTCAGGGATGG + Intergenic
912998148 1:114552346-114552368 TGGTCCAATGGCCTGGGAGAAGG - Intergenic
913489998 1:119370187-119370209 CTGGCCAATGGCCTGGGAGTGGG - Intronic
915893564 1:159793513-159793535 CTGTCCAATGGTCAAGTGGCTGG - Intergenic
918945129 1:191053894-191053916 CTGTCCAATCGTCTGGGAGCTGG - Intergenic
919324911 1:196094806-196094828 ATGTCCAATTTTCTGGGGGCTGG + Intergenic
921786479 1:219236902-219236924 CTGTCAAGGGGTGTGGGGGAGGG - Intergenic
923537434 1:234863875-234863897 CTGCCAAATGGGCTGGGTGAAGG - Intergenic
1063503891 10:6579690-6579712 CTGGTCAAGGGCCTGGGGGAGGG - Intronic
1067456223 10:46421138-46421160 CAGTCCCCTGGTCTGGGGTAGGG - Intergenic
1067630976 10:47963501-47963523 CAGTCCCCTGGTCTGGGGTAGGG + Intergenic
1068360239 10:55968150-55968172 GTATGCAATGGTGTGGGGGATGG - Intergenic
1069021137 10:63489841-63489863 CTGGTCCATGGTCCGGGGGATGG - Intergenic
1069615948 10:69806265-69806287 CTGTGCAATGGCCTGGGGGTGGG + Intronic
1070537805 10:77392430-77392452 CTGTCCAAGGGACTGAGAGATGG + Intronic
1072021650 10:91409590-91409612 CCGTCCAATCCTATGGGGGAAGG + Intergenic
1073429224 10:103475611-103475633 CTGGCCAATGGTGCGGTGGAGGG - Intronic
1075651882 10:124132643-124132665 CTGCCCCATTGTCTGGGGGGCGG + Intergenic
1075725561 10:124609031-124609053 CTGTCCAGAGCCCTGGGGGACGG + Intronic
1077585151 11:3445827-3445849 CTGGTCTGTGGTCTGGGGGATGG + Intergenic
1077815798 11:5684285-5684307 CTTTCCACTGTTTTGGGGGAGGG + Intronic
1080235372 11:30062528-30062550 CTGACAAAGGGCCTGGGGGAGGG - Intergenic
1082882112 11:58047894-58047916 CTGTCCAGTGATGTGGAGGAAGG - Intronic
1083265287 11:61543942-61543964 CAATCCAGTGGTCTTGGGGAGGG + Intronic
1084112306 11:67022337-67022359 CTCTCCAACGGTCTGGGGTGGGG - Intronic
1084268431 11:68016740-68016762 GAGCCCAATGGGCTGGGGGAAGG - Intronic
1084759977 11:71264421-71264443 CTGTCCACTTGACTGGGTGAAGG + Intergenic
1085026164 11:73237858-73237880 CTGGACAATGGTCTGGGGCCAGG - Intergenic
1085518773 11:77126226-77126248 CTGTCCGCTGGTCAGAGGGAAGG + Intergenic
1086804051 11:91217297-91217319 CTGGTCCATGGTCTGGGGGTTGG + Intergenic
1087208898 11:95426147-95426169 CTGGCCAATGGACTGTGGGAAGG - Intergenic
1087599780 11:100298815-100298837 TTGTCCTATGGTCTGGTGGTCGG - Intronic
1090756674 11:129797931-129797953 CTGACCAATGGTGTGGGAGCTGG + Intergenic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1092291759 12:7163569-7163591 TCGTCCAATGGTCTGGGAGGGGG - Intergenic
1092412297 12:8263092-8263114 CTGGTCTGTGGTCTGGGGGATGG + Intergenic
1092936278 12:13367102-13367124 CTGTCCATTGGACTGGGGGAAGG + Intergenic
1093291767 12:17333481-17333503 CTGTCCAAAGGTCTGTGTCAGGG - Intergenic
1094041450 12:26124822-26124844 CTGTACAATAATCTGTGGGACGG + Exonic
1096262905 12:50104102-50104124 CTGTCAAGTGATATGGGGGAAGG + Intronic
1097726733 12:63083742-63083764 CTGTCAAATGGGCTAGGGAAAGG + Intergenic
1100157994 12:91823943-91823965 CTGACAAATGGTCTGTGGGAAGG + Intergenic
1102691675 12:114766230-114766252 CTGTGCATGGGTCTGGGGGGGGG - Intergenic
1103917906 12:124385432-124385454 CTGTCTCACGGTGTGGGGGAAGG - Intronic
1105213372 13:18270973-18270995 CTGCACAAAGGTCTGGGGGCCGG - Intergenic
1107418539 13:40223695-40223717 CTGGCTAATGATCTGGAGGAGGG - Intergenic
1107460687 13:40599022-40599044 ATGTACAATGTTTTGGGGGAAGG + Intronic
1109044183 13:57387064-57387086 CTGTGGAACGGTCTGGGGGGTGG - Intergenic
1111716615 13:91886929-91886951 CTGTTCTAGGGTCTGGAGGATGG + Intronic
1120065605 14:80037732-80037754 TTTTTCCATGGTCTGGGGGAGGG - Intergenic
1121271088 14:92638805-92638827 CTGTCAAATGGTCTGGGGACCGG - Intronic
1124235863 15:27989000-27989022 CAGTCCAGTGGTCTGCAGGAGGG - Intronic
1124360694 15:29034791-29034813 GTTTTCATTGGTCTGGGGGAGGG + Intronic
1124917813 15:33994066-33994088 CTGATCCATGGTCTGGGGGTGGG - Intronic
1125972828 15:43926025-43926047 CTGTGCTAAGTTCTGGGGGAAGG - Intronic
1129184809 15:73899570-73899592 CTGGCCAAGGGTCTGGAGGTGGG + Intergenic
1129387986 15:75206472-75206494 CTCTCAACTTGTCTGGGGGAAGG + Exonic
1130961222 15:88659742-88659764 CTGTCCAGTGTTCTGCGGGCTGG + Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1132626523 16:894167-894189 CAGTCCAGTGGACAGGGGGACGG - Intronic
1132626534 16:894199-894221 CAGTCCAGTGGACAGGGGGACGG - Intronic
1132626545 16:894231-894253 CGGTCCAGTGGACAGGGGGACGG - Intronic
1133353564 16:5119318-5119340 CTGGTCCATGGTCTGGGGGCTGG + Intergenic
1136364779 16:29805031-29805053 CAGCCCACTGGACTGGGGGAGGG + Intronic
1138458004 16:57132365-57132387 CTGTGCAAAGGTCTGGGAGGAGG + Intronic
1139922510 16:70468961-70468983 CTGTCCAGGTGACTGGGGGAGGG + Exonic
1140722637 16:77785057-77785079 CTTGCAAATGGTCTGGGGCAGGG - Intergenic
1141620788 16:85235679-85235701 CCACCCAATGGTCTGGGGGAGGG - Intergenic
1142068199 16:88074645-88074667 CTTTCCAGCTGTCTGGGGGAAGG + Intronic
1142206148 16:88784226-88784248 CTCTGCCCTGGTCTGGGGGAGGG - Intronic
1142369376 16:89669838-89669860 TTCTCCAATGCTCTCGGGGAGGG + Exonic
1142369489 16:89670206-89670228 TTCTCCAGTGCTCTGGGGGAGGG + Exonic
1143682013 17:8482551-8482573 CTGTCCACTGGCTTGGGGGTGGG + Intronic
1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG + Intergenic
1147159181 17:38560687-38560709 CTGTGGAATGGTTTGGGGGAGGG - Intronic
1147425596 17:40344614-40344636 ATGTCCAGTGGTTTAGGGGAAGG - Intronic
1148026230 17:44589640-44589662 CTGTTCAGTGTTCTGAGGGAAGG + Intergenic
1148645804 17:49219247-49219269 CTCTGAGATGGTCTGGGGGAGGG + Intronic
1148880383 17:50721000-50721022 GTGACAAATGGTCGGGGGGATGG - Intronic
1149743384 17:59070068-59070090 CTTTCAAATGGCCTGGGGTATGG + Intronic
1150445386 17:65224252-65224274 CTGGCCTATGCTCTGGGGGCTGG + Intronic
1151319903 17:73346789-73346811 CTCTCCAAAGACCTGGGGGAAGG + Intronic
1151526856 17:74676052-74676074 CAGGGCAATGGTCTGGGGTAGGG + Intronic
1151712113 17:75812916-75812938 CTGTCCCATGGCCTGGGAGGAGG + Intronic
1152911877 17:83009925-83009947 CCGTCCACTGCTGTGGGGGAGGG + Intronic
1156069992 18:33195638-33195660 CTGTTCAATAGTCTGTGGAAGGG - Intronic
1157286262 18:46379443-46379465 CTGTAAAATGGACTCGGGGAGGG - Intronic
1157572654 18:48723294-48723316 ATGTCAAATGGACTAGGGGAGGG + Intronic
1157698585 18:49744974-49744996 CACTCCCATGGTCAGGGGGATGG + Intergenic
1160162710 18:76486860-76486882 CTGACCAAGGTTCGGGGGGAAGG + Intronic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1160876833 19:1300358-1300380 CTGTGCCCTGGCCTGGGGGAGGG + Intergenic
1162930348 19:13954329-13954351 CTGTCCGCTGATCTGGGGAAGGG - Exonic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1165386788 19:35514530-35514552 CTGGCCCCTGGCCTGGGGGATGG - Intergenic
1167390336 19:49190534-49190556 CTGGCCATGGCTCTGGGGGAAGG + Intronic
1168149713 19:54439091-54439113 CTGCCCAATGAGCTTGGGGATGG - Intergenic
926104676 2:10142690-10142712 GTGTGCAATGGACTGGCGGAGGG - Intronic
928226982 2:29458428-29458450 CTTTCCAATGCTCTGGGCTAAGG + Intronic
928259208 2:29751470-29751492 CTGCCCCATGGTCTCGGGGATGG + Intronic
929525905 2:42702768-42702790 CTGTGCAGTGTTCTGGGGCACGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934300951 2:91775771-91775793 CTGCACAAAGGTCTGGGGGCCGG + Intergenic
934736952 2:96694349-96694371 CTCTCCAAGCTTCTGGGGGAGGG - Intergenic
935156407 2:100487350-100487372 CTGTGCAATGGGCTGGGGTGTGG - Intergenic
936618017 2:114068236-114068258 GTCTCCAGTGGTCTGGGGGCAGG + Intergenic
936881146 2:117252392-117252414 CTGTCTAAGGGTTTGGGGCAAGG - Intergenic
937395284 2:121529968-121529990 CAGTACAAAGGTATGGGGGAGGG + Intronic
937751076 2:125476842-125476864 CTGTTCTAGGGTCTGGAGGATGG - Intergenic
940208948 2:151236650-151236672 CTGTGCAATGTTTTGGGGGAGGG - Intergenic
940748502 2:157597386-157597408 CTGGCCGCTGCTCTGGGGGAGGG - Intronic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
942267398 2:174242219-174242241 CGGACCAAGGGTGTGGGGGATGG + Intronic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944927473 2:204479767-204479789 CATTGCAATGGTGTGGGGGAGGG - Intergenic
945017967 2:205539750-205539772 CTGTGCAATGACCTGGGGGAGGG - Intronic
946466919 2:219920205-219920227 TTGTCCAGTGGTCTGGGACAGGG - Intergenic
946741523 2:222807184-222807206 CTGTCCTATGGTGTGGCTGACGG + Intergenic
946927044 2:224636448-224636470 CTGTTCCATGGCCTGGGGGTTGG - Intergenic
946952535 2:224892729-224892751 CTGTCCAATGCCCTTGGGCAGGG + Intronic
948903469 2:240967293-240967315 CAGTCCAATGGGCGGGTGGAGGG - Intronic
1170789731 20:19497874-19497896 CTGGTCCATGGTCTGGGGAATGG - Intronic
1170818900 20:19739444-19739466 CTGGCCACGGGTTTGGGGGATGG + Intergenic
1170827379 20:19808574-19808596 CCATCCATTGGACTGGGGGAGGG - Intergenic
1171958517 20:31476968-31476990 CTGCACAATGGTCAAGGGGAGGG + Intronic
1172484115 20:35288188-35288210 CTGTCAAATGGACTTGGGGGAGG + Intronic
1173900728 20:46586784-46586806 CTGACCCCTGGTCTGGGGGATGG - Intronic
1174440631 20:50549483-50549505 TTGTACAGTGGTCTGGGGCAAGG - Intronic
1175733773 20:61371596-61371618 CTGCCCGGTGGTCTTGGGGAAGG - Intronic
1179016154 21:37595849-37595871 CTGCCCAATAGCCTGGTGGATGG + Intergenic
1180816204 22:18791373-18791395 CTGCGCAAAGGTCTGGGGGCCGG - Intergenic
1181202393 22:21225705-21225727 CTGCGCAAAGGTCTGGGGGCCGG - Intronic
1181638698 22:24185942-24185964 CTTTCCCAGGGTCTGGGGCACGG - Intronic
1181699313 22:24610909-24610931 CTGCGCAAAGGTCTGGGGGCCGG + Intronic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1184695613 22:46137300-46137322 CTGTCCATGGGCCTGGGGCACGG - Intergenic
1185111605 22:48903138-48903160 CTGTCCCATCGTTGGGGGGAAGG - Intergenic
1203224520 22_KI270731v1_random:69708-69730 CTGCGCAAAGGTCTGGGGGCCGG + Intergenic
1203266307 22_KI270734v1_random:17084-17106 CTGCGCAAAGGTCTGGGGGCCGG - Intergenic
949389024 3:3538131-3538153 CTGACCCATGGTCTGGGGCCAGG + Intergenic
950205385 3:11076275-11076297 CTGTCCTAAGCTCTGGGAGATGG - Intergenic
952242951 3:31552712-31552734 CTGTCCAAAGGACTCGTGGATGG - Intronic
953914529 3:46909848-46909870 CTTTCAACTGGTCTGAGGGAAGG + Intergenic
953929826 3:47000324-47000346 CTCTCCAATGTGCTGGAGGACGG + Exonic
954322707 3:49842924-49842946 CTGTCCATGGGTCTGGGTGTTGG - Intronic
955320061 3:57968028-57968050 CTGCCCCATACTCTGGGGGAAGG + Intergenic
956142366 3:66158937-66158959 CTGTCCCACAGTATGGGGGAAGG - Intronic
956268503 3:67425028-67425050 CTGGCTAAAGGTGTGGGGGAAGG - Intronic
957616522 3:82535018-82535040 CTGTTCACTGGTCTATGGGAAGG + Intergenic
959717071 3:109444527-109444549 CTGTCCAAGGGCCTTGGGGGTGG + Intergenic
960479411 3:118170737-118170759 CTCTCCAATGTCATGGGGGAAGG + Intergenic
960754722 3:120999055-120999077 TTGTCCTATGGTCTGAGTGATGG + Intronic
961058646 3:123810232-123810254 CTGTCCTGAGGTCTGGGGGAGGG - Intronic
961295939 3:125884420-125884442 CTGGTCAGTGGTCTGGGGGCTGG - Intergenic
961889859 3:130121753-130121775 CTGGTCTGTGGTCTGGGGGATGG + Intergenic
962651377 3:137496820-137496842 CTGGCCATTTGTCTGGGGTAAGG + Intergenic
965520626 3:169665637-169665659 CTGTCCCCTGGCCTAGGGGATGG - Intergenic
967108880 3:186275357-186275379 CTGTCCATTGGACTTGGGTAGGG + Intronic
968284909 3:197502825-197502847 CTGAACAATGTCCTGGGGGATGG + Intergenic
968395537 4:233273-233295 TAGTCCAGTGGCCTGGGGGAAGG + Intergenic
969000339 4:3975723-3975745 CTGGTCTGTGGTCTGGGGGATGG + Intergenic
969088136 4:4671689-4671711 CTGTCAACTGGGCTGGGAGAGGG + Intergenic
969813571 4:9669123-9669145 CTGGTCTGTGGTCTGGGGGATGG - Intergenic
971036700 4:22701188-22701210 CTGTCACAAGGTGTGGGGGAAGG - Intergenic
973088390 4:46098837-46098859 CTGTACAATGGTTGGGGGGTTGG + Intronic
973772516 4:54219694-54219716 CTGGCCTAAGCTCTGGGGGATGG + Intronic
975040409 4:69739154-69739176 CTATTCTAGGGTCTGGGGGATGG + Intronic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
978048689 4:104167652-104167674 CAGACCAGTTGTCTGGGGGATGG - Intergenic
980954450 4:139414238-139414260 CTGGACAAGGGTCTGGGGTAAGG + Intronic
991317638 5:65327363-65327385 CTGCCCAGTTGTCTGGGGAAGGG + Intronic
997285522 5:132675414-132675436 CTGTTCTATGGTCTGGGTGCTGG - Intronic
997743434 5:136278041-136278063 CTGTCCAAGGACCTGGGTGAGGG + Intronic
998529380 5:142870914-142870936 CTGTCCCAAAGTCTGGGGAATGG + Intronic
1001750484 5:174126645-174126667 CTGGCCAATGGAGTGTGGGAGGG + Intronic
1003561341 6:7183362-7183384 TTGTCCAATGGGCTGATGGATGG - Intronic
1003631689 6:7793353-7793375 GTGGCCAAGGGTTTGGGGGAAGG + Intronic
1004184949 6:13413693-13413715 CTGTCCCATGGTCCAGGGGGTGG - Intronic
1004897106 6:20159152-20159174 CTGGCCCATGGCCTGGGGGTTGG - Intronic
1009029382 6:58038224-58038246 CTGTCCAGTGGCCAGGTGGATGG - Intergenic
1010678125 6:78768036-78768058 CTGTTCTGTGGTCTGGAGGATGG - Intergenic
1010867938 6:81003703-81003725 CTCTCCAATTGTATGGGGTATGG - Intergenic
1011724641 6:90197770-90197792 CAGTCCATTGGTTTGGGGCAGGG + Intronic
1014021924 6:116601075-116601097 CTGCCTAATGGTCTTGGAGATGG - Intergenic
1014436285 6:121424492-121424514 CTGTCCCCTGGTCTCTGGGAGGG - Intergenic
1020281712 7:6653337-6653359 CTGGGCAACGGCCTGGGGGAGGG + Exonic
1021695404 7:23271310-23271332 CTGGCCATCGGTCTGGGGGTGGG + Intronic
1021777968 7:24072469-24072491 CTGGCAGATGGGCTGGGGGAAGG + Intergenic
1022190682 7:28014271-28014293 CTGTTCAATGGCTTGGGTGATGG - Intronic
1023885435 7:44350495-44350517 CTGGCCAAAGGACTGGGGAAAGG + Intergenic
1023988666 7:45114256-45114278 CTGTCCATGGGACAGGGGGAAGG - Intergenic
1024420394 7:49159222-49159244 CTCTCCAAAGGTTGGGGGGAAGG + Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1027482233 7:78712850-78712872 CTTTCCATTTGTCTTGGGGATGG - Intronic
1028890552 7:95983494-95983516 CTGCCTCATGGTCTGGGGCAGGG + Intronic
1029609001 7:101616676-101616698 ATGACCAGTGGTCTGGGTGAGGG + Intronic
1031939197 7:127769321-127769343 CTGTCCACAGGTCAGGGAGACGG + Intronic
1034685354 7:152966331-152966353 CTGGCTAACGGTCTGGGGGTTGG + Intergenic
1035303555 7:157915506-157915528 CTCTCCATTGGGCTGGAGGATGG - Intronic
1036102604 8:5803173-5803195 CTCTGCCAGGGTCTGGGGGATGG - Intergenic
1036376890 8:8208269-8208291 CTGGTCTGTGGTCTGGGGGATGG - Intergenic
1036852646 8:12214870-12214892 CTGGTCTGTGGTCTGGGGGATGG + Intergenic
1036874017 8:12457393-12457415 CTGGTCTGTGGTCTGGGGGATGG + Intergenic
1038052549 8:23827423-23827445 CGGTCCCATGGTTTGGAGGAGGG + Intergenic
1045911604 8:107416722-107416744 CTGCCCCATGCTCTGGAGGAAGG - Intronic
1046667083 8:117015959-117015981 GTGTCTAATGGTTTGGGAGAAGG + Intronic
1047286994 8:123495887-123495909 CTGGTCCATGGTCTGGGGGTTGG + Intergenic
1047319349 8:123765023-123765045 CTGTGCAAAGGTCTGGGGAAAGG + Intergenic
1048170870 8:132104925-132104947 CTGTCTCATGGTCTGGGAAAGGG + Intronic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1053001061 9:34577676-34577698 GTGTCCATTGGCCTGGGGGAGGG - Intronic
1053153175 9:35755783-35755805 CTGGCCTGTGGCCTGGGGGATGG + Exonic
1053447918 9:38167146-38167168 CTGTCCAGTGGTTTGGGCCAAGG + Intergenic
1054456004 9:65430732-65430754 CTGACCACTGGGCTGTGGGAGGG + Intergenic
1056057568 9:82843230-82843252 CTGTCGAGGGGTCAGGGGGAGGG + Intergenic
1056419591 9:86410593-86410615 ATGTGCAGTGGTCTGGGGGAAGG + Intergenic
1056692388 9:88818922-88818944 CTGTCCAAGGGTCTACGAGATGG + Intergenic
1058112476 9:101046310-101046332 CTGTAAAACAGTCTGGGGGAAGG - Intronic
1061452472 9:130675804-130675826 GTGTTCAGTGGTCTGGGGGAGGG + Intronic
1188192865 X:27193790-27193812 CTGTCCCAGGGTGTGGGGGTGGG - Intergenic
1188890498 X:35606227-35606249 CTGTCCTATACTCTGGGGAAAGG + Intergenic
1189394854 X:40611902-40611924 CTGTTCATTGTACTGGGGGACGG + Intergenic
1195142006 X:101970861-101970883 CTATCAAATGGCCTGAGGGATGG + Intergenic
1196906887 X:120446122-120446144 CTGTGCAATGGTCTGTGGACTGG - Intronic
1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG + Intergenic
1198178122 X:134175052-134175074 CTGGGCTGTGGTCTGGGGGAGGG - Intergenic
1200686517 Y:6264309-6264331 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200989387 Y:9335225-9335247 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200992062 Y:9355558-9355580 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200994715 Y:9375836-9375858 CTGGCCAAATGTCTGGGAGATGG - Intronic
1200997378 Y:9396182-9396204 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200999892 Y:9464719-9464741 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201002551 Y:9485028-9485050 CTGGCCAAATGTCTGGGAGATGG - Intronic
1201005208 Y:9505313-9505335 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201007869 Y:9525642-9525664 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201010485 Y:9545832-9545854 CTGGCCAAATGTCTGGGAGATGG - Intergenic