ID: 1132237051

View in Genome Browser
Species Human (GRCh38)
Location 15:100229936-100229958
Sequence CAGGGAAAGCCTGCCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 306}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132237046_1132237051 18 Left 1132237046 15:100229895-100229917 CCAGCAGGAAATTGCCACACAGT 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG 0: 1
1: 0
2: 2
3: 33
4: 306
1132237044_1132237051 24 Left 1132237044 15:100229889-100229911 CCCTGACCAGCAGGAAATTGCCA 0: 1
1: 1
2: 1
3: 27
4: 282
Right 1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG 0: 1
1: 0
2: 2
3: 33
4: 306
1132237047_1132237051 4 Left 1132237047 15:100229909-100229931 CCACACAGTCACCTGAGATGATC 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG 0: 1
1: 0
2: 2
3: 33
4: 306
1132237050_1132237051 -7 Left 1132237050 15:100229920-100229942 CCTGAGATGATCAGTGCAGGGAA 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG 0: 1
1: 0
2: 2
3: 33
4: 306
1132237045_1132237051 23 Left 1132237045 15:100229890-100229912 CCTGACCAGCAGGAAATTGCCAC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG 0: 1
1: 0
2: 2
3: 33
4: 306
1132237043_1132237051 28 Left 1132237043 15:100229885-100229907 CCTTCCCTGACCAGCAGGAAATT 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG 0: 1
1: 0
2: 2
3: 33
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132237051 Original CRISPR CAGGGAAAGCCTGCCTGTGT TGG Intronic
902245732 1:15119240-15119262 CAGGGACTGCCTGCCTGCCTGGG - Intergenic
902571514 1:17350016-17350038 CAGGGAAGGCCTCACTGAGTAGG - Intronic
903208699 1:21802717-21802739 CGGGGACAGCCTGCCTTTGCTGG - Intergenic
903290851 1:22313402-22313424 CAGGGATAGCGTGGCTGTGGGGG - Intergenic
903597198 1:24503468-24503490 CAGGCCCAGCCTGCCTGTGAAGG + Intronic
903650989 1:24921900-24921922 CAGGGAAGGCCTGACTGAGAAGG - Intronic
904356389 1:29942773-29942795 CAGGGAAGGCCTGTCTGAGGAGG + Intergenic
904545405 1:31266738-31266760 TTGGTAATGCCTGCCTGTGTTGG - Intronic
904600965 1:31672468-31672490 GAGGGAGATCCTGGCTGTGTTGG - Exonic
904604537 1:31691493-31691515 CAGGGAGACCCTGGCTTTGTTGG - Exonic
905523171 1:38615631-38615653 CAAGGAAGGCCTGTCTGTGAAGG - Intergenic
908832797 1:68197247-68197269 CAGTGAACGCCTGCCTTTTTAGG + Intronic
909531831 1:76690905-76690927 CAGTGAATGCCTGCATGTGTAGG + Intergenic
909564214 1:77036952-77036974 CAAGGAAAGCCTCCCTGGGGAGG + Intronic
910772205 1:90841836-90841858 CAGGTTATGCCTGGCTGTGTCGG + Intergenic
912880417 1:113406866-113406888 CAGGGAAAGCATCCCTGAGGAGG + Intronic
912924156 1:113898698-113898720 CAGGTAATGCCTGCCTTTTTAGG - Exonic
914674054 1:149894350-149894372 CAGGGAAAGCCTAGGTGTGAAGG - Intronic
914804250 1:150981300-150981322 CAGTGAAGGCCTTCCTGAGTTGG + Intergenic
915722558 1:157995209-157995231 AAGGCAAAGCCTGGCTGAGTTGG + Intronic
921246835 1:213252241-213252263 CAGGGAAAGATTGTCTGTGTAGG + Intronic
922203583 1:223427593-223427615 CAGGGAAAGCCTCTCTGAGATGG + Intergenic
922731173 1:227949392-227949414 CTGGGAAAGCCTGGCCATGTGGG + Intergenic
1064915952 10:20458420-20458442 AAAAGAAAGCCTGTCTGTGTGGG - Intergenic
1065995469 10:31055843-31055865 CAGGCAATGCCTGCCTGCTTGGG + Intergenic
1067760408 10:49040801-49040823 CAGGGAAAGCCTCCATTTATTGG - Intronic
1068178285 10:53489969-53489991 CAGAGAAAGCCTGGCTGCATCGG - Intergenic
1069911840 10:71764860-71764882 CAGGGAAAGCCTGGCAGTGCAGG + Intronic
1070342396 10:75509965-75509987 CAGGGCAACCCTGTCTGTTTTGG - Intronic
1071566696 10:86674873-86674895 CAGGAGCAGCCTGCCTGGGTGGG - Intronic
1072208126 10:93222276-93222298 CAGGGAAAGCCTCTCTGAGGAGG - Intergenic
1072981944 10:100105785-100105807 CCAGGAAAGCGAGCCTGTGTTGG - Intergenic
1073077243 10:100831817-100831839 CAGGGCAAGGCTCCCTGTCTGGG - Intergenic
1073181071 10:101583567-101583589 CAGTGAGAGCGTGCCTGTCTTGG - Exonic
1073583566 10:104688336-104688358 CAGGCAGAGGCTGCGTGTGTGGG + Intronic
1073773822 10:106764422-106764444 CAGGGAAAGCCTTCCGCTGGTGG - Intronic
1074694080 10:116031925-116031947 TAGGGAAGGTCTGTCTGTGTAGG + Intergenic
1075615510 10:123888192-123888214 CATAGAAAATCTGCCTGTGTGGG + Intronic
1076509439 10:131001886-131001908 GAGGGGAAGCCTTGCTGTGTAGG - Intergenic
1077391204 11:2301386-2301408 CACGGAAACCCTGCCTGTACTGG + Intronic
1077995657 11:7449994-7450016 CAGGCAAAGCATGCCTGCTTGGG - Intronic
1078238600 11:9509293-9509315 CAGGGGCAGCCAGCCTGTTTGGG + Intronic
1080379583 11:31754535-31754557 CAGGGAAAGCCTTTCTGAGAAGG - Intronic
1081445992 11:43132019-43132041 CAGGGAAAGCCTCTCTGTTAAGG + Intergenic
1084088888 11:66867450-66867472 CGGGGAAATCCTGCCAGTGTAGG - Intronic
1084145602 11:67263630-67263652 GAAGGAAGGCCTGCCTGTGAAGG + Intergenic
1085067405 11:73509880-73509902 TAGGGAAAGCCTCCCAGAGTTGG - Intronic
1087883211 11:103444676-103444698 CAGGGAAAGCCTGTCTTTGGAGG + Intronic
1089010016 11:115124520-115124542 CAGGGAAAGCAGGCAGGTGTGGG - Intergenic
1089189935 11:116646357-116646379 CAGAGCAGGCCTGGCTGTGTAGG + Intergenic
1089728370 11:120503256-120503278 CAGGGGAATGTTGCCTGTGTAGG + Intergenic
1090963923 11:131581812-131581834 CAGGGAAAGGCTGCAAGTGCTGG - Intronic
1091976251 12:4827881-4827903 CAGGGATAGGAAGCCTGTGTGGG + Intronic
1093651501 12:21650968-21650990 CAGGGAAGGCCTGCCTGAAAAGG + Intronic
1096691413 12:53324452-53324474 CTGGGAAAGCCTCCCTGAGAAGG + Intronic
1097794550 12:63847428-63847450 AAAGGAAAACCTGACTGTGTGGG + Intronic
1098468289 12:70814209-70814231 CAGGGACAGCCTGCCCCTCTAGG - Intronic
1099693124 12:85986205-85986227 CAGGGAGAGCCTGGCTGTTCAGG - Intronic
1099993211 12:89749310-89749332 CAGGGAAGGCCTCACTGTGGAGG - Intergenic
1100009203 12:89933701-89933723 CATGAAAAGCCTGTCTGTATTGG - Intergenic
1100014425 12:89991694-89991716 GAGAAAAAGACTGCCTGTGTTGG - Intergenic
1100415968 12:94375275-94375297 CAAGGAAAGCCTCCCTGGTTAGG + Intronic
1100462000 12:94809052-94809074 CAGGGAAGGCCTTTCTGTGGAGG - Intergenic
1101739908 12:107492768-107492790 CAGTGAAAGCCAGCATGTTTAGG + Intronic
1102582574 12:113900027-113900049 CAGGGAGAGCGTGCCTGTACCGG - Intronic
1102727520 12:115078701-115078723 CAGGGACAGACTGCCTGGGCTGG + Intergenic
1103175419 12:118859180-118859202 AATGGAAAGCCTGACTCTGTTGG - Intergenic
1103564158 12:121807005-121807027 CTGGGAAACCCTGCCTGGGAGGG + Intronic
1104919656 12:132283865-132283887 CAGGGAAAAGCAGCCTGTCTGGG + Intronic
1107573619 13:41691426-41691448 CAGGAACAGCCTGACTGTGCTGG - Exonic
1108590263 13:51906704-51906726 CGGGGAGTGCCTGCCTGTGCTGG - Intergenic
1110569756 13:76991415-76991437 CAAGGAACACCTGCCTGTGAGGG + Exonic
1111375968 13:87379521-87379543 CAGGGAAAGCCAGCCTATTTTGG - Intergenic
1111992820 13:95133734-95133756 AAGGAAGAGCCTGCCTGTGGTGG + Intronic
1113882001 13:113632240-113632262 CTGCAAAAGCCTGCCTGTGTTGG + Intronic
1114046537 14:18880994-18881016 CAGGGAAAGCCTCTCTGTCTCGG - Intergenic
1114229614 14:20768645-20768667 CAGGGAAAGCCTGTATCAGTGGG - Intronic
1115431940 14:33329422-33329444 CAGTGAAAGCCTCTCTGGGTTGG + Intronic
1115975812 14:38995770-38995792 CAGGGAGAGCTTGCCTGAGAAGG - Intergenic
1117207931 14:53463745-53463767 CAGAGAAAGCCTAACTGTGAAGG - Intergenic
1118054235 14:62062718-62062740 CAGCAAATGGCTGCCTGTGTTGG - Intronic
1118820578 14:69342844-69342866 CAGGGAAAGTCTCCCTGGGAAGG - Intronic
1119877862 14:78075790-78075812 CAGAGGAAGCCTGTGTGTGTAGG + Intergenic
1121337859 14:93088178-93088200 CAGGGAGAGCAGGCCTGGGTGGG - Intronic
1122016820 14:98803460-98803482 CAGGCAGAGGCTGCCTGTGTTGG - Intergenic
1122492230 14:102126076-102126098 CAGGGAAAGCCTCTCTGAGAAGG + Intronic
1124085675 15:26548656-26548678 CAAGGAGAGCCTACCTGAGTTGG - Intronic
1124143089 15:27094606-27094628 CAGGGAGAGCCTTCCCTTGTTGG + Intronic
1124252767 15:28117736-28117758 CAGGGAGTGACTGCCTGTGTTGG - Intronic
1124621679 15:31277567-31277589 GAGGGAGAGCCTGTCAGTGTGGG - Intergenic
1125389597 15:39177826-39177848 CAGAGAAACCCTCCCAGTGTGGG - Intergenic
1125486736 15:40116356-40116378 CAGAGACATCCTGGCTGTGTTGG - Intergenic
1126329572 15:47517621-47517643 CAGGTAAAGATTTCCTGTGTGGG - Intronic
1127294137 15:57594998-57595020 CAGGGGAAACCAGCCTATGTGGG + Intronic
1127843064 15:62846989-62847011 GCGGAAAACCCTGCCTGTGTGGG + Intergenic
1128726199 15:69990254-69990276 CAGGGAAGTCCTCCCTGTGCAGG - Intergenic
1128779789 15:70351828-70351850 CAGGGAAAGCCTTTCTGAGGAGG - Intergenic
1128889431 15:71317691-71317713 AAGGAAGAGGCTGCCTGTGTAGG + Intronic
1130726776 15:86447367-86447389 CAGGGAAAGCCTGAAGCTGTTGG + Intronic
1132140123 15:99385290-99385312 CAGGGAAAGGCGGACTGTGTTGG + Intronic
1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG + Intronic
1132760652 16:1507143-1507165 GAGGGAGGGGCTGCCTGTGTGGG + Intronic
1132918260 16:2366829-2366851 CAGGGGACACCTGCCAGTGTGGG + Intergenic
1136075851 16:27816861-27816883 CAGTGCAAGCCTGCCTGGGGTGG - Intronic
1136122944 16:28152142-28152164 CAGGCAAAGACTGCTTGTGAAGG + Intronic
1136318474 16:29467354-29467376 CAGGGAAGACCTCCCTGTGGAGG - Exonic
1136433049 16:30206703-30206725 CAGGGAAGACCTCCCTGTGGAGG - Exonic
1136568880 16:31085161-31085183 CAGGGACAGCTGGCCTGTGGCGG - Exonic
1137270190 16:46898036-46898058 CAGGGAAAGGCTGGCTGGGCTGG + Intronic
1137807653 16:51322570-51322592 AAGAGAAAGCTTGCTTGTGTGGG - Intergenic
1137960621 16:52878362-52878384 CAGGGAAAGACAGCTTTTGTAGG - Intergenic
1138447298 16:57072196-57072218 CAGGGATGGCCTGCCTGAGAAGG - Intronic
1138884575 16:61060744-61060766 CAGGCAAAGCCTGGATGTATAGG + Intergenic
1139277961 16:65745440-65745462 CTGGGAAAGCCTGCTTGCTTTGG + Intergenic
1139967483 16:70753887-70753909 CAGGGAAAGGCTGGCTGGGCTGG + Intronic
1141139161 16:81486195-81486217 CTGAGAAAGCCTGGCTGTGATGG - Intronic
1141252308 16:82369746-82369768 CTTCGAAAGGCTGCCTGTGTTGG + Intergenic
1141468266 16:84221443-84221465 CAGGGAGGGCCTGGCTGTGCTGG + Exonic
1141817892 16:86425356-86425378 GAGGGAAAGCCTGCATTTGCTGG + Intergenic
1143275431 17:5706287-5706309 CAGGGCAGGCCTGCCTTTCTGGG + Intergenic
1144313093 17:14032233-14032255 CAGGGCCAGATTGCCTGTGTTGG + Intergenic
1144381092 17:14698991-14699013 CAAGGAAAGTCTGCATGTTTGGG - Intergenic
1144783329 17:17818618-17818640 CAGGGAAGGCCTCCCTGAGATGG - Intronic
1145236950 17:21214764-21214786 CAGGGACAGCGTGTCTGTCTCGG - Intergenic
1145729039 17:27158603-27158625 CAGGGAGAGCAGGCCTGTCTCGG + Intergenic
1146150347 17:30463196-30463218 CAGGGAAAGCCTCTCCGTGGAGG - Intronic
1146927641 17:36755903-36755925 CAGGGAAGGCCTGGCTGGGGAGG - Intergenic
1147047847 17:37767962-37767984 AAGAGAAACCCTGCCTTTGTGGG - Intergenic
1147195504 17:38763853-38763875 CTGGGAAAGCCTCCCTGAGGTGG + Intronic
1147571492 17:41573915-41573937 GAGGCAATGCCTGCATGTGTAGG + Intergenic
1147991021 17:44333557-44333579 CAGGGAAAGCTGGCCTGGGGCGG + Intergenic
1148198643 17:45733129-45733151 CTGGGAGAGCCTGGCTGTGGGGG + Intergenic
1148257800 17:46151417-46151439 CAGGGAAAGCCTCTCTGAGGAGG - Intronic
1149231881 17:54544463-54544485 CTTGGCAAGCCTGCCTGTTTAGG + Intergenic
1149658356 17:58322024-58322046 CAGGGAAGGCCTCCCTGAGGAGG - Intronic
1149680666 17:58504865-58504887 CCGGGAAGGCCGGCCTGTGCTGG - Exonic
1152018500 17:77767956-77767978 CAGGGAAAGCATGCCTTTCCGGG - Intergenic
1152511674 17:80793952-80793974 AAGGGAAAACCTCCGTGTGTTGG - Intronic
1152710290 17:81867884-81867906 CAGGGAAGGCCTGCCGGGGGTGG + Exonic
1152723110 17:81932500-81932522 GAGGGAGGCCCTGCCTGTGTGGG - Intronic
1152920942 17:83066346-83066368 CAGGGAAGGCCAGCCTGCGGCGG - Intergenic
1153728421 18:7981206-7981228 TAGGGAAAGCCTCCCTGAGGAGG - Intronic
1154167094 18:12023821-12023843 CAGGGTGAGCCTGCCTGTTAGGG + Intronic
1157404970 18:47414980-47415002 CAGGGAAATCATGCTTGTCTGGG - Intergenic
1157562440 18:48658013-48658035 CAGGTACAGTCTGCCTGTGAGGG + Intronic
1158491050 18:57910064-57910086 CAGGGAAAGCCTCTCTCTGGGGG + Intergenic
1159014082 18:63087623-63087645 CAGGGACAGACTGCCTGGATTGG - Intergenic
1159247753 18:65831368-65831390 GCGGTAAAGCCTGCCTTTGTTGG - Intronic
1160348255 18:78152219-78152241 ACGGGAAAGGCCGCCTGTGTTGG - Intergenic
1160494687 18:79365924-79365946 CAGGGACAGCCTGTGTGTGATGG + Intronic
1162128597 19:8512190-8512212 GAGGTAAAGCCTGGCTGGGTGGG + Intronic
1162773695 19:12965808-12965830 CAGGGAAGGCCTCCCCGAGTAGG - Intronic
1162909442 19:13841449-13841471 CAGGCAAGGCCTGCCTGTTGGGG + Intergenic
1164806542 19:31121349-31121371 CAGGAAATGTCTGCCGGTGTAGG - Intergenic
1165844620 19:38810133-38810155 CAGAGAAGGCCTGCCTGGGAAGG - Intronic
1165882597 19:39054105-39054127 CAGGGGAAGCCTGGCTGGGAAGG - Intergenic
1166780526 19:45340388-45340410 CAGGGAAGGCCTGCCGGAGGAGG + Intronic
1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG + Exonic
1168474720 19:56667558-56667580 CAGGGAATGCCTGTGTGTGAGGG - Intronic
925522463 2:4762081-4762103 CAGAGATGGCCTGCCTGTGAGGG + Intergenic
925840807 2:7990123-7990145 CAGAGCAAGCCTGCCTTTCTTGG - Intergenic
926994048 2:18714788-18714810 CAGGCAAAGCCAGCTTATGTAGG + Intergenic
927861536 2:26562893-26562915 CAGGGAGCGCCTTCCTGTGAAGG - Intronic
929753176 2:44738832-44738854 CAGGGAAGGCCTCCCTGAGAAGG + Intronic
929758045 2:44784592-44784614 CAGAGAAAGCCTCCCTGAGGAGG + Intergenic
930333874 2:50020689-50020711 CAGGTAGAGCTAGCCTGTGTTGG + Intronic
930606271 2:53496485-53496507 CAGGAAAAGCCTCCCTGAGAAGG - Intergenic
931176303 2:59858482-59858504 GAGGGGCAGCCTGCGTGTGTTGG - Intergenic
933268266 2:80204934-80204956 CAGGGAAAGAGAGCTTGTGTAGG + Intronic
933975425 2:87505409-87505431 CAGAGGGAGCCTGCCTGTGTTGG - Intergenic
936318401 2:111445404-111445426 CAGAGGGAGCCTGCCTGTGTTGG + Intergenic
936558905 2:113519591-113519613 CAGGGAAAGCCTCTCTGTTTAGG - Intergenic
936926793 2:117745308-117745330 CTTGGAGGGCCTGCCTGTGTGGG - Intergenic
937059601 2:118971389-118971411 GAGGGTAAGCCCTCCTGTGTGGG - Intronic
938560856 2:132470752-132470774 CACGGAAAGGCTTCCTGGGTGGG + Intronic
938683597 2:133716029-133716051 GAGGGAAAGCCTGCATGGGAGGG + Intergenic
938812905 2:134870101-134870123 CTGGGGAAGCCTGACTCTGTAGG - Intronic
939489702 2:142862306-142862328 CCGGGCACTCCTGCCTGTGTGGG + Intergenic
939988380 2:148854748-148854770 CTGGGAAAGGCTGTCTGGGTGGG - Intergenic
940006120 2:149010758-149010780 CAGGGAAAGCCTCCAAGTGCAGG + Intronic
941499268 2:166249160-166249182 CAGAGAAAGCCTGCCTATAAAGG - Intronic
942910606 2:181238963-181238985 CAGGGAAAGACTAAATGTGTGGG + Intergenic
943298744 2:186171523-186171545 GAGGGAAAGCCAGCCTAAGTAGG - Intergenic
943559007 2:189439096-189439118 CAGGGAAAGCCTTACTGAGAAGG - Intergenic
945208083 2:207353380-207353402 AAGAGAAAGCCTTCCTGTTTAGG - Intergenic
946769165 2:223070627-223070649 TAGCGAAACCCTGCCTGAGTAGG + Intronic
948460493 2:238127819-238127841 CAGGAAAGGCCTGGCTGTGCTGG - Intronic
948481154 2:238251438-238251460 CAGGGAGAGTGTGTCTGTGTGGG + Intronic
948524772 2:238564694-238564716 CAGGGAAAGCCAGCCGGAGCAGG + Intergenic
948701980 2:239766299-239766321 CAGGGCACCCCTGCCTTTGTGGG - Intronic
948835315 2:240623591-240623613 CGGGCAAGGCCTGCCTGAGTGGG + Intronic
948965509 2:241376558-241376580 CGGGACAAGCCTGCCTCTGTGGG - Intronic
948987895 2:241536481-241536503 CAAGGGGAGCCTGCCTGGGTAGG - Intergenic
1170458722 20:16556811-16556833 CAGGGAAGGACTGGCTGTGTAGG - Intronic
1170912661 20:20589679-20589701 CAGAGAAAAAGTGCCTGTGTTGG + Intronic
1171367980 20:24639418-24639440 CTGTGAAAGCCTTCGTGTGTGGG - Intronic
1171721497 20:28568266-28568288 CAGGGAAAGGCTGGCAGTGGTGG + Intergenic
1172509947 20:35493611-35493633 GTGGGAAAGCCTGGCTGTGTTGG - Intronic
1172634653 20:36401815-36401837 CAGGGAAGGCCTCCCTGAGGAGG + Intronic
1172967221 20:38845555-38845577 CAGGGAGAGCCTGTCTGAGGAGG + Intronic
1173527632 20:43745138-43745160 AAGGGGAAGCCTGCCGGGGTGGG + Intergenic
1173549550 20:43923141-43923163 GAGGGGAAACCTGCCTGCGTGGG + Intronic
1173839125 20:46145763-46145785 CAGGATCAGCCTGCATGTGTAGG + Intergenic
1173898845 20:46572165-46572187 CAGGGTGAGCCTGGGTGTGTGGG - Intronic
1175756376 20:61533028-61533050 CAGGGAATGCCAGCTGGTGTGGG + Intronic
1176978078 21:15346961-15346983 CAAGTAAAGCCTCCCTTTGTGGG + Intergenic
1179187920 21:39098829-39098851 CACACAAAGCCTTCCTGTGTGGG - Intergenic
1179357957 21:40679096-40679118 AAGGCAAAGAGTGCCTGTGTTGG - Intronic
1179799198 21:43803005-43803027 CAGGGAAGGCTTCCCAGTGTGGG - Intronic
1182194942 22:28506335-28506357 CAGGGAGGTCCTGCCTGTGAGGG - Intronic
1183030304 22:35098897-35098919 CAGGGAAGGCCTCCCTGGGAAGG - Intergenic
1184084121 22:42248203-42248225 CAGGGAAAGCCTGTCAGTGTGGG + Intronic
1184778153 22:46633478-46633500 CAGGGAAGGGCTGGCTGTGTGGG + Intronic
1185095450 22:48803811-48803833 CTGGCCAAGCCTGACTGTGTGGG + Intronic
950053974 3:10011078-10011100 CAGAGAGTGCCCGCCTGTGTTGG + Intronic
950206546 3:11085211-11085233 CAGGGAAGACCTCCCTGTGGAGG - Intergenic
950314373 3:11987600-11987622 CAAGGAAAGACTGACTGGGTTGG + Intergenic
950424101 3:12915308-12915330 CCAGGAAAGCCTGCCAGTGTCGG + Intronic
950744601 3:15077042-15077064 CAGGTAAAGCCATCCTGGGTTGG - Exonic
954659414 3:52218974-52218996 CAAGGCAAACCTGCCTGTCTTGG - Intergenic
955605918 3:60703271-60703293 CAGGGACATCCTGCCTTTGAAGG - Intronic
956091054 3:65667473-65667495 GAAGGAATGCCTGCGTGTGTGGG + Intronic
956570075 3:70684319-70684341 TAGGGAAATTCTGCCTGTGAGGG - Intergenic
956921863 3:73938172-73938194 TAGGGGAACCCAGCCTGTGTAGG - Intergenic
957945599 3:87058652-87058674 CAGGGAAAGAGAGCTTGTGTAGG + Intergenic
959881438 3:111448501-111448523 CAGGGGTGGCCTGCCTGTGCAGG - Intronic
961013323 3:123449549-123449571 CGGGAGAAGCCTGCCTGCGTCGG - Exonic
961166659 3:124768210-124768232 GAGGGGAAGCCTGCCAGTGAGGG + Intronic
961449291 3:126995238-126995260 GGGGGAGAGGCTGCCTGTGTGGG - Intronic
961549920 3:127663634-127663656 CAGGGAAAGCCTCTTTGAGTTGG + Intronic
961812946 3:129532213-129532235 TAGGGAGACCCTGCCTGTGAGGG - Intronic
963940555 3:151092227-151092249 CAAGGAAGGCCTCCCTGTGGGGG - Intronic
964717572 3:159738840-159738862 CAGGGAAGGCCTGACTGAGGAGG + Intronic
965345161 3:167539703-167539725 CAGGGAAGGCTTGCCTGAGTAGG - Intronic
967040109 3:185684283-185684305 CAGAGAATGCCTCCCTGTGTAGG - Intronic
967296585 3:187971077-187971099 GAGGGAAATCCTGGCTGTGCAGG + Intergenic
968434809 4:578958-578980 CAGGGAAATCCTGCCTCTTATGG - Intergenic
970119377 4:12735567-12735589 CAGGGTAGCCATGCCTGTGTGGG - Intergenic
971121537 4:23710237-23710259 CAGGGACAGCCTGTCTCAGTCGG - Intergenic
971377709 4:26068384-26068406 CAGGGAAAAGATGTCTGTGTGGG - Intergenic
971405290 4:26317245-26317267 CAGGGAAGGCCTCCCTGAGGAGG + Intronic
973744317 4:53948334-53948356 CAGGGAAAGCTTCCCTGTGGAGG + Intronic
973827515 4:54723383-54723405 CTGGGAAAGCCTTTCTGGGTTGG + Intronic
975380049 4:73689649-73689671 TGTGGAAAGCCTTCCTGTGTGGG + Intergenic
976404240 4:84643913-84643935 CAGGGAAAGCCTTTCTGAGGAGG + Intronic
980170174 4:129280014-129280036 CAGGGAAAACTTGCCTGTTGTGG + Intergenic
981695614 4:147556122-147556144 CAGAGAAAGCCTCCCTGAGGAGG + Intergenic
982911122 4:161144237-161144259 CTGGGAAAGCCTGGGTGTCTAGG + Intergenic
982971054 4:161987066-161987088 CAGGGAATGCGTGACTGTCTTGG - Intronic
985546198 5:510394-510416 CAGAGAGAGCCTGACTGTGCTGG - Intronic
985851388 5:2391257-2391279 CAGGGAGAACATGGCTGTGTAGG + Intergenic
988508040 5:31841341-31841363 TAGGGAAAGCCTGGCTTAGTGGG - Intronic
988634711 5:32970308-32970330 CAGGGAAACCTTGACTGAGTTGG - Intergenic
990508700 5:56470443-56470465 CAGAGAAAGCTTCCCTGTGGAGG + Intronic
991158513 5:63467099-63467121 AAAGGAAAGCCTACCTCTGTGGG - Intergenic
992789158 5:80198296-80198318 CAGAGAAAGCTTGACTGTGCTGG - Intronic
996015589 5:118530688-118530710 CAGGGAAGACCTCCCTGGGTAGG - Intergenic
996121520 5:119679247-119679269 CAGATAAAGCATGCCTGTGAGGG - Intergenic
997599139 5:135127537-135127559 CTGGAAAAGCCTGCCTGTTCAGG + Intronic
998163206 5:139825214-139825236 CAGGGAAAGCCTGCAAGGTTTGG + Intronic
998413235 5:141926988-141927010 CAGGGAAAGCCTGTCTGTGGGGG - Intronic
999695178 5:154182452-154182474 CAGGGAAATGCTATCTGTGTGGG - Intronic
999781102 5:154851065-154851087 CAGGAAAGGCATGCCTGTGGAGG + Intronic
1000189749 5:158898829-158898851 CAGTGAAAGACTGCCTGAGGTGG + Intronic
1001684671 5:173584528-173584550 CACAGAAAGGCTGCCTGTGGGGG + Intergenic
1002576388 5:180176482-180176504 AGGGGAAAGGCTGCCTGTGCGGG + Intronic
1003286866 6:4742071-4742093 CAGGGAAAGGCTGGGTGTGGTGG + Intronic
1003514584 6:6807291-6807313 CAGGAAGGGCGTGCCTGTGTTGG + Intergenic
1005533241 6:26729617-26729639 CAGGGGAAGCCTTCTTCTGTGGG + Intergenic
1005537553 6:26772047-26772069 CAGGGGAAGCCTTCTTCTGTGGG - Intergenic
1006178332 6:32137543-32137565 GAGGGAAAGCCTCCTTGTGGAGG + Intergenic
1006376949 6:33676954-33676976 CAGGGCAGGCCTCCCTGTGAGGG + Intronic
1006428692 6:33982225-33982247 CAAGGGAAGCCTGCCTGGGGAGG + Intergenic
1006450368 6:34102537-34102559 CAGGGAAGGCCTGCCTGAGAAGG - Intronic
1007168219 6:39843503-39843525 CTGGGAAAGGCTGCCTGCGCTGG + Intronic
1008514844 6:52309114-52309136 CAGGGAAGGCTTCCCTGTGGAGG + Intergenic
1009008428 6:57814457-57814479 CAGGGGAAGCCTTCTTCTGTGGG - Intergenic
1009695331 6:67095932-67095954 GAAGGAATGCCTGCCTCTGTAGG + Intergenic
1009990420 6:70836294-70836316 CAGGCAAAGACAGCCTGTGTAGG + Intronic
1011591234 6:88972503-88972525 CAGGGAACACCTGCCTGTCCAGG - Intergenic
1012217941 6:96611759-96611781 CAGTGAAAGCCTGCCAAGGTGGG - Intronic
1014781264 6:125567568-125567590 CAGGGAAAGCCAGCCAGTCCAGG - Intergenic
1017764036 6:157592720-157592742 CAGGGAGGGCCTGGCTGGGTGGG + Intronic
1017826908 6:158088492-158088514 CAAGGAAGGCCTGGCTCTGTGGG + Intronic
1018370077 6:163159971-163159993 TGGGGAAAGCCAGCCTCTGTCGG - Intronic
1018860552 6:167708115-167708137 CAGGGGGAGGGTGCCTGTGTTGG + Intergenic
1019191147 6:170251659-170251681 CAGGAAAAGGCGGCCTGTGGGGG - Intergenic
1022304307 7:29132115-29132137 CAGGGAAGGCCCCCCTGAGTAGG + Intronic
1023376141 7:39557462-39557484 CAGGGAAACCCCACCTCTGTTGG - Intergenic
1024198670 7:47084878-47084900 CAGGGAATGCGTGTTTGTGTTGG - Intergenic
1028044652 7:86102179-86102201 CAGGTAAAGCCTGCATGCATTGG - Intergenic
1028102455 7:86837797-86837819 CATGGTAGGCTTGCCTGTGTTGG - Intronic
1030024503 7:105310020-105310042 CAGGGAAATCCTCCCTCTGGGGG + Intronic
1030600339 7:111584702-111584724 CAGGCAAAGCCACCCTGAGTGGG + Intergenic
1032491530 7:132327929-132327951 CAGGGAGAGCCGCCCTGTGTGGG + Intronic
1033285515 7:140037670-140037692 CCAGCAGAGCCTGCCTGTGTTGG - Intronic
1033824689 7:145174987-145175009 CAGGGAAAGCCTCTCTGAGAAGG - Intergenic
1034339416 7:150341979-150342001 CAGGGCAGCCCTGCCTGGGTAGG - Intergenic
1034893436 7:154859900-154859922 CAGAGAAAGCGTGCGTGTGGCGG + Intronic
1035062758 7:156081342-156081364 CAGGTTCAGCCTGCCTTTGTAGG - Intergenic
1035185463 7:157122856-157122878 CATGGAAAGCCTGCGTGGGGTGG - Intergenic
1037383891 8:18317329-18317351 CAGGGAAAGCTTCCCTGGGAAGG - Intergenic
1038823158 8:30971886-30971908 CAGGCAATGCCTGCCTGTTCTGG - Intergenic
1039833083 8:41233326-41233348 CAGGAAAGGCCTCCCTGTGATGG + Intergenic
1041031665 8:53742487-53742509 TAGAGAAAGCCTCCCTGAGTAGG - Intronic
1042015023 8:64299350-64299372 CAGAGAAAGCCTTCCTGAGTAGG - Intergenic
1044821610 8:96159426-96159448 GTGGGAACGCCTGCATGTGTGGG - Intronic
1044827056 8:96208702-96208724 CAGGGAAAACCTCCCTGAGGAGG - Intergenic
1045770081 8:105726755-105726777 GAGGGAAAGCCTGCCTGTTGTGG + Intronic
1047955219 8:129969643-129969665 GAAGGAAAGACTGGCTGTGTTGG - Intronic
1048007854 8:130433371-130433393 TAGGGAAATCCTGCCTATCTTGG + Intronic
1048934078 8:139340983-139341005 CATGCAAAGCCTTCCTGTGGTGG - Intergenic
1049266817 8:141671964-141671986 AAGGGACAGCCTGTCTTTGTTGG - Intergenic
1049328921 8:142039320-142039342 CAGGGACCGCCTGGCTGTGCAGG + Intergenic
1049893946 9:96590-96612 CAGGGAAAGCCTCTCTGTTTAGG + Intergenic
1051822129 9:21180920-21180942 CAGGGGAAGGGTGCCTGTGCTGG - Intergenic
1051827167 9:21233579-21233601 CAGGGGAAGGGTGCCTGTGCTGG - Intronic
1052102484 9:24465951-24465973 CAGTAAAAGACAGCCTGTGTTGG + Intergenic
1053199041 9:36140412-36140434 CAGGGAAACCCTTCCTTTGAAGG - Intronic
1053735174 9:41096674-41096696 CAGGGAAAGCCTCTCTGTTTAGG + Intergenic
1054693207 9:68334723-68334745 CAGGGAAAGCCTCTCTGTTTAGG - Intronic
1055487035 9:76766305-76766327 CAGGCAAAGCCTATCTGTGTGGG + Intronic
1057552944 9:96065371-96065393 CAGGGGCAGGCTGCCTGTGCTGG + Intergenic
1057672883 9:97110523-97110545 CAGGGAAAACCTCTCTGAGTGGG + Intergenic
1060015200 9:120080834-120080856 AAGGGAAAGGCTGCCTTTCTGGG - Intergenic
1060032344 9:120225880-120225902 CAGGGAAGGCCTCTCTGAGTAGG - Intergenic
1061036743 9:128118509-128118531 CAGGAAAAGCCTGTCTGTGAAGG + Intergenic
1062120806 9:134833123-134833145 CAGGGAAGGCCTGGCTGGGCAGG - Intronic
1185887055 X:3792383-3792405 CTGGGAATGCTTGACTGTGTGGG + Intergenic
1188592223 X:31851854-31851876 CAGGGAAAGCCTCACTGAGTAGG + Intronic
1190737588 X:53266135-53266157 CAAGGTTAGCCTGCCCGTGTTGG + Intronic
1190905476 X:54722969-54722991 CAGGGAAAGTCTCCCTGAGGAGG - Intergenic
1191968605 X:66788888-66788910 CAGGGAAAGCCTTACTGAGTAGG - Intergenic
1192207323 X:69105112-69105134 CCGGGACAGCCTGCCAGGGTGGG + Intergenic
1192833944 X:74779611-74779633 CAGGGAGATCTTGCCTATGTTGG - Intronic
1192911498 X:75609452-75609474 CAGGGAAAGACTGGATGAGTTGG + Intergenic
1193882132 X:86936381-86936403 CAGGTGAAGCCTGCCAGTGAAGG + Intergenic
1195478366 X:105314460-105314482 CAGGCTAAGCCAGACTGTGTCGG + Intronic
1196212271 X:113009412-113009434 CAGTGAAAGCCTGTCAGTGCTGG - Intergenic
1197704012 X:129620766-129620788 CAGGGCAAGACTACCTATGTTGG - Intergenic
1197934748 X:131728875-131728897 CTCGGAAAGCCTCCCTGTGGGGG + Intergenic
1201990058 Y:20014160-20014182 CAGTGAAATCCCGACTGTGTTGG + Intergenic