ID: 1132242569

View in Genome Browser
Species Human (GRCh38)
Location 15:100269890-100269912
Sequence TGGGCTGGCTGAAGTAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132242569_1132242578 28 Left 1132242569 15:100269890-100269912 CCTTTTCTACTTCAGCCAGCCCA 0: 1
1: 0
2: 3
3: 28
4: 257
Right 1132242578 15:100269941-100269963 ATCCCCAACCAATACAAGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1132242569_1132242577 27 Left 1132242569 15:100269890-100269912 CCTTTTCTACTTCAGCCAGCCCA 0: 1
1: 0
2: 3
3: 28
4: 257
Right 1132242577 15:100269940-100269962 AATCCCCAACCAATACAAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132242569 Original CRISPR TGGGCTGGCTGAAGTAGAAA AGG (reversed) Intronic
900226011 1:1534017-1534039 TGTGCTGGCTGAAGGCGGAAGGG + Exonic
900427053 1:2585707-2585729 TGGGCGGGCTGGAGAAGGAAGGG - Intergenic
900516358 1:3084109-3084131 TGGGCTCCCTGGAGGAGAAAGGG + Intronic
901598829 1:10406531-10406553 TGTGGTGGCAGAAGTACAAATGG + Intronic
901639378 1:10685757-10685779 TGGGCTGACTGGAGTGGACAGGG - Intronic
902548933 1:17208005-17208027 TGGGCTGGCAGCAGGAGGAAGGG + Intronic
902584261 1:17428361-17428383 GGGGCCAGCTGAATTAGAAATGG - Intronic
903117141 1:21187657-21187679 TAGGCTGGCTGAAGTGCAATGGG - Intergenic
905014767 1:34770193-34770215 TAGGCTGGCTGCAGAAGGAAGGG - Intronic
905598561 1:39230423-39230445 TGGGCTTTCAGAAATAGAAAAGG + Intronic
909451305 1:75800549-75800571 TGGGCTGGGAGGAGTAGAGAGGG + Intronic
911198616 1:95021139-95021161 TGGGCTGGAAAAAGTAGAATAGG - Intronic
911307663 1:96250643-96250665 TAGGTTGGCTTAAGCAGAAAAGG - Intergenic
912495224 1:110087263-110087285 TGGTCTGGCTGAAGTGGAGGTGG - Intergenic
914756100 1:150562342-150562364 TGGGCGGGCAGAAAGAGAAAGGG - Intergenic
915915287 1:159937051-159937073 TGGCCTGGGTGCAGTAGACAGGG - Intronic
916192319 1:162191584-162191606 TGGGCTGGCAGAAGAAGATAAGG + Intronic
918289441 1:183092604-183092626 TGGGCTGGCTCTAATGGAAAGGG + Intronic
919666736 1:200299969-200299991 AGGGTTGGCTGAAGTTGAAGGGG - Intergenic
919842238 1:201618132-201618154 TGGGGTGGCTGGGGAAGAAAGGG - Intergenic
920497669 1:206467072-206467094 TGGGCAGGATGCAGTAGAACGGG + Intergenic
921892347 1:220366099-220366121 AGGGCTGCCTGAAGTAAACAAGG + Intergenic
922340224 1:224648991-224649013 TGGGCTGGCTGAAGAAGCCAGGG - Intronic
923013985 1:230111986-230112008 CAGGCTGGCTTAAGCAGAAAAGG + Intronic
1062830196 10:600321-600343 TGGGCTGGCTGAGGAAGGAGTGG - Intronic
1066320182 10:34295218-34295240 TGGGGTGGGTGAAGCAGCAAGGG + Intronic
1067702340 10:48583043-48583065 CGGGCTGGCTGAAGAAGCAGAGG - Exonic
1068542870 10:58314859-58314881 TTGGGTGGCTGAAGAAGAAGAGG - Intergenic
1068669901 10:59711851-59711873 AGGGCTGGCCTGAGTAGAAATGG - Intronic
1069386340 10:67886047-67886069 TCGGCAGGCTGAAGGAGAATCGG - Intronic
1070206861 10:74272856-74272878 TGGGCTGACTGAAGTTGAACAGG - Intronic
1070649652 10:78225705-78225727 TGGTCTGGCTGAAGTCGAGTGGG - Intergenic
1071342639 10:84662873-84662895 TGGGCTCGCTGGAGTGGGAATGG + Intergenic
1072071427 10:91921811-91921833 TGAGATGGGAGAAGTAGAAAGGG - Intergenic
1073809426 10:107136461-107136483 TGGGTTTGCTGCAGTAGTAAAGG + Intronic
1073965571 10:108985215-108985237 AGGGCAGGCTGGAGTGGAAAAGG + Intergenic
1074707576 10:116148830-116148852 AGAGCTGGCTGAACTAAAAATGG + Intronic
1076637854 10:131894117-131894139 TGGGCTGGCTGGAAGAGCAATGG - Intergenic
1076816892 10:132919512-132919534 TGGGCTGGCTGCCTGAGAAAAGG + Intronic
1076942036 10:133616380-133616402 TGGGCTGGCCCAAATAAAAAGGG - Intergenic
1078269477 11:9781569-9781591 TGATCTGGCTGAAGTAGAAATGG - Exonic
1078533031 11:12151675-12151697 TGCCCTGGCAGAAGTAGAAAAGG + Intronic
1078616433 11:12870347-12870369 GGGGATGGTTGAACTAGAAAGGG + Intronic
1078748575 11:14138728-14138750 TGGGCTTACTGAAGTAGAAATGG - Intronic
1078985236 11:16587904-16587926 TGGGCTGGATGAAATAGGCAGGG - Intronic
1081634489 11:44711825-44711847 AGGGGAGGATGAAGTAGAAATGG + Intergenic
1083259311 11:61514592-61514614 TGGGCTGGGTGGGGAAGAAAGGG + Intergenic
1083271516 11:61575215-61575237 ATGGCTGACTGAAGGAGAAAGGG - Intronic
1083674755 11:64319096-64319118 AGAGCAGGATGAAGTAGAAAGGG - Intronic
1084157309 11:67321052-67321074 TGGGATAGCAAAAGTAGAAAAGG + Intronic
1085050042 11:73375728-73375750 TGGGATGGCTGTAGTAGGGAGGG + Intergenic
1086770005 11:90750282-90750304 TAGGCTGTTTTAAGTAGAAAAGG - Intergenic
1087353991 11:97071214-97071236 TGGGCTAGTTTCAGTAGAAATGG + Intergenic
1088359035 11:108971993-108972015 TGGGAAGGTTGAAGGAGAAATGG - Intergenic
1088521781 11:110709742-110709764 TGAGGTGGCAGAAGTAGACAGGG + Intronic
1089444912 11:118544198-118544220 TGGGGTGGCAGTAGTAGAGATGG - Intronic
1090904657 11:131064678-131064700 TGGGCTAACTGTAGGAGAAATGG - Intergenic
1091086028 11:132722744-132722766 TGGGCAGGATCAAGTAGAAGAGG + Intronic
1091935650 12:4432592-4432614 TGTGCTGGGTGAGGAAGAAAAGG - Intronic
1093113431 12:15180631-15180653 TGCACTGGCTGAAGTAAATAGGG + Intronic
1097103140 12:56603651-56603673 TGGGCGGTCTGAAGTAGAGATGG - Exonic
1097132996 12:56827373-56827395 TGGGCTGGCCTGAGTAGAAAAGG + Intergenic
1098664332 12:73141662-73141684 TGGTCTGGGTGAAATAGAAATGG - Intergenic
1098988777 12:77041935-77041957 TGTGCTGGGTGAGGTAGATATGG - Intronic
1099456651 12:82870854-82870876 TGGGCTGGCTGAGTGAGAAAAGG + Intronic
1099804129 12:87496249-87496271 TGTGCTGGCTCTAGTAGTAAGGG + Intergenic
1100422819 12:94454193-94454215 TGGAGTGGATGAAGTTGAAATGG - Intronic
1102090477 12:110183220-110183242 AGTGCTGGCTGAAGTACAATGGG + Intronic
1102304996 12:111798173-111798195 TGGGCTGGATGAAGTAACCACGG - Exonic
1104940673 12:132393161-132393183 TAGACTGGCTTAAGTAGAAAAGG + Intergenic
1105272146 13:18887525-18887547 TGAGGTGGCTGAATTTGAAAAGG - Intergenic
1105632901 13:22188920-22188942 TGGGAAAGCTGAAGTACAAATGG - Intergenic
1106718436 13:32415318-32415340 TGTGCTTGCTAAAGAAGAAAGGG + Intronic
1106987482 13:35372503-35372525 TATGCTGGCTGAGGTAGACAGGG + Intronic
1108038310 13:46315476-46315498 TGGAGTGGCTGAAGTACATAGGG + Intergenic
1108401854 13:50053046-50053068 TGAGCAGGCTGAGGAAGAAAAGG - Intergenic
1110607956 13:77454985-77455007 TGAGATGACTGAAGGAGAAAGGG - Intergenic
1114791163 14:25660091-25660113 TGGGCTGGCTAAGGTAGGAATGG - Intergenic
1118993254 14:70814525-70814547 TGGGCTGGCTCTTTTAGAAAAGG - Intergenic
1120702151 14:87709990-87710012 TATTGTGGCTGAAGTAGAAAAGG - Intergenic
1120757409 14:88257189-88257211 TGGGTTGGAGGAAGGAGAAACGG - Intronic
1121832540 14:97064528-97064550 TGGGCTGGCCCAAGTATAGAGGG - Intergenic
1123486740 15:20747496-20747518 TGAGGTGGCTGAATTTGAAAAGG - Intergenic
1123543230 15:21316546-21316568 TGAGGTGGCTGAATTTGAAAAGG - Intergenic
1123878971 15:24656770-24656792 TGGGCAGGCTGAAGAAGAGGTGG + Intergenic
1124855157 15:33380478-33380500 TGGGAAGGCTGAACTAGAGATGG + Intronic
1125384605 15:39124034-39124056 TGGAATGGCAGAAGTAGAAGTGG + Intergenic
1125679897 15:41524022-41524044 TGGGGTGGCTGGAGTGTAAAGGG - Intronic
1125899475 15:43331462-43331484 CTGACTGGCTGAAATAGAAAAGG + Intronic
1127271408 15:57405237-57405259 TGGGGTGGGTGAAGTGAAAAAGG - Intronic
1127792477 15:62410625-62410647 TGGGCTGGGTGGAGTGGAATTGG + Intronic
1127907093 15:63383935-63383957 TGGGGTGGCAGCAGAAGAAAGGG + Intergenic
1128748950 15:70134822-70134844 TGGGGTAGCTGGAGTAGGAATGG - Intergenic
1129004214 15:72358703-72358725 TGGGCTGAAAGAAGTAGATACGG + Intronic
1129826046 15:78635688-78635710 AGGGCTGGCTGAAGCAGCGAAGG + Intronic
1131619211 15:94049225-94049247 TGTGCTGGATGAAGTAGAGGGGG + Intergenic
1132242569 15:100269890-100269912 TGGGCTGGCTGAAGTAGAAAAGG - Intronic
1132391865 15:101445035-101445057 GGAGCAAGCTGAAGTAGAAAAGG - Intronic
1202951549 15_KI270727v1_random:43676-43698 TGAGGTGGCTGAATTTGAAAAGG - Intergenic
1134218340 16:12333806-12333828 TAGGATGGCTGAGGTAGAAAAGG + Intronic
1134792168 16:16998858-16998880 TGGACTGGGTGAAGAAGGAAGGG + Intergenic
1137222823 16:46472656-46472678 TGGACTGGCTGGAAAAGAAAAGG + Intergenic
1137249541 16:46731996-46732018 TGGGCTGGCTGCAGGGGTAAGGG - Intronic
1137394782 16:48109152-48109174 TGGGCATGCTGAAGTGGTAAAGG + Intronic
1139228793 16:65260688-65260710 TTTTCTGGCTGAAGCAGAAATGG - Intergenic
1139613141 16:68073110-68073132 TGTGGTGGCTGAAGCAGGAAGGG + Intronic
1140121737 16:72089504-72089526 CGGGATGGCAGCAGTAGAAATGG - Intronic
1140553080 16:75888417-75888439 GGGGCTGGGTGAAGAAGAATGGG - Intergenic
1140644847 16:77018328-77018350 TTGGCTGTCTGAATTACAAATGG + Intergenic
1141617884 16:85220574-85220596 TGGGGAGGCTGAAGTTCAAAAGG - Intergenic
1141755479 16:85987898-85987920 TGGGGTGGATGAATTAAAAAAGG + Intergenic
1142365857 16:89649294-89649316 TTCGCTGGCTGAAGCAGGAATGG - Intronic
1144004750 17:11089824-11089846 GGGGCTGGAGGAATTAGAAAGGG - Intergenic
1145104505 17:20103896-20103918 TGAGCTGGCTGGAGGAGAAGGGG + Intronic
1148004514 17:44415223-44415245 TGGGATGGCTAAAATAAAAATGG - Intronic
1148706163 17:49634726-49634748 TGGCTTGGCTGAAGTATAGATGG - Intronic
1148995539 17:51706151-51706173 TGGGCTGTTGGAAGAAGAAACGG + Intronic
1149457941 17:56803969-56803991 TGCACTGGCTGAGTTAGAAATGG + Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150321936 17:64222004-64222026 TGGGCTGGCAGAGGAGGAAATGG + Intronic
1152139260 17:78526674-78526696 TGGGGTCGCTGAAGGAGAACGGG + Exonic
1155073895 18:22338755-22338777 TGGGCAAGCTGAGGTAGAGAGGG - Intergenic
1156007861 18:32464766-32464788 TGAGATGGCTGTAGTAGATACGG - Intronic
1156164234 18:34398835-34398857 TTGGCTGGATGCAGTGGAAAGGG + Intergenic
1156626244 18:38912767-38912789 TGGGCTGACTATACTAGAAAAGG - Intergenic
1157475842 18:48023021-48023043 TCAGCTAGCTTAAGTAGAAAAGG - Intergenic
1158407311 18:57171578-57171600 TGGGTTGGTTGAATTAGAAAAGG + Intergenic
1158962696 18:62599663-62599685 TGGGCTGGGGGAAGTGGAGAGGG - Intergenic
1159966472 18:74600176-74600198 TTGGCTGACTTAAGCAGAAAAGG + Intronic
1160787097 19:905724-905746 AGGGCTGCCTGAAGCAGGAAGGG + Intronic
1161099194 19:2412575-2412597 TGGGTTGGTTGGGGTAGAAAAGG - Intronic
1164188128 19:22890097-22890119 AGGGCTGACTGAAGTAGAGAAGG - Intergenic
1165816957 19:38648217-38648239 TGGGCAGGCTGAAATGGAACTGG + Intronic
1166053224 19:40273623-40273645 TGGGCAGGCTGCAAAAGAAACGG + Intronic
1167692398 19:50994394-50994416 TGATGTGGCTGAAGAAGAAAAGG + Intergenic
1168314802 19:55480093-55480115 TGGGTTGGCTGGAGGTGAAAGGG + Intronic
926267890 2:11343707-11343729 TGGGCAGGCGGAAGGAGAAGAGG + Intronic
927129830 2:20049650-20049672 TCGGATGGTTGAAATAGAAATGG + Intronic
927143145 2:20143173-20143195 AGGTCTGGCTGGTGTAGAAATGG - Intergenic
928137662 2:28700279-28700301 GGGCCTGGCTGAAGCAGAAGAGG - Intergenic
930614504 2:53579313-53579335 TGGGGTGGCTTAAGCAGAGATGG + Intronic
930891015 2:56388104-56388126 TAGGCTGGATGATGTAAAAAGGG - Intergenic
931226473 2:60336184-60336206 TGGGCTGTGTGAGGTAGAACAGG - Intergenic
932087561 2:68775308-68775330 TGGGCTGGCTGAAGAAGCAGAGG + Exonic
933644205 2:84797416-84797438 TCAGCTGGCTCATGTAGAAAGGG - Intronic
934715021 2:96538106-96538128 TGGTGTGGCAGAGGTAGAAAGGG + Intronic
939077210 2:137618112-137618134 ATGGCTGGCTGGAGTAGAAGAGG - Intronic
939551440 2:143620564-143620586 TTGGCTGGCAGAAGCAGAAAGGG - Intronic
940538545 2:154979842-154979864 TGGGGTGGCAGAGGCAGAAAAGG + Intergenic
941277752 2:163512231-163512253 TGAGCAGGCTGAAGTAGACGAGG + Intergenic
942339795 2:174931899-174931921 TGGTCAGGCTGAAGCAGAATGGG + Intronic
946472884 2:219979173-219979195 TGGGCTAGCTTAAGCAAAAAAGG - Intergenic
948133599 2:235619683-235619705 TGGGCTGGCTGCACTAGAAGGGG + Intronic
948659483 2:239498308-239498330 TGGGCTGGCTGCAGAAGACTCGG - Intergenic
949051070 2:241897564-241897586 TGGGTTGGCAGAAGTAGAAATGG + Intronic
1169502689 20:6176389-6176411 CTGGCTGGTTGAAGTAGAAGAGG - Intergenic
1169667191 20:8050533-8050555 GGGGCTGGCTGATGTTTAAAGGG + Intergenic
1170175192 20:13460998-13461020 TGAGCTGGAAGAAGTAGTAAGGG - Intronic
1171153275 20:22846724-22846746 TGGGTTGGCTCAAGCAGAAATGG - Intergenic
1171154621 20:22860675-22860697 TGAGCTAGCTTAAGTCGAAAGGG + Intergenic
1172080482 20:32336901-32336923 TGGGGTGGGTAAAGTAGGAAAGG + Intergenic
1172999983 20:39098728-39098750 GGGGCTGGAGGAAGGAGAAAGGG - Intergenic
1173132555 20:40408353-40408375 TGGACTGGCTGCAGAAGAAATGG - Intergenic
1173628494 20:44491720-44491742 TGGGATGGCTGAAGGAGGGAAGG + Exonic
1174347162 20:49938648-49938670 TCGGAAGGCTGAACTAGAAAAGG + Intronic
1174770638 20:53296911-53296933 TGGAATGAATGAAGTAGAAAGGG + Intronic
1175073551 20:56355045-56355067 TGAGCTGGCTGAGGAGGAAAAGG - Intergenic
1175981166 20:62739395-62739417 GGGCCTGGCTGAAGCACAAAGGG + Intronic
1178032788 21:28546775-28546797 TGGGCTGGGTGAATAAAAAAGGG + Intergenic
1178361328 21:31950695-31950717 TTTGCTGGCAGAAGTGGAAATGG + Intronic
1178420759 21:32441515-32441537 GAGGCTGGATGAAGTAGAAGGGG + Intronic
1178437938 21:32575861-32575883 TGGGCTGGCAAATGGAGAAAGGG + Intergenic
1178536102 21:33411537-33411559 TGTGCTGCCTGACGTACAAAAGG + Intronic
1182233714 22:28859239-28859261 GGGGCTGCGTGAAGGAGAAATGG - Intergenic
1182381438 22:29892246-29892268 TGAGGTGGCTGAATTTGAAAAGG + Intronic
949669361 3:6380676-6380698 CAGGCTGGCTGGAGCAGAAATGG + Intergenic
950689749 3:14646444-14646466 GGGGCTGCCTGAAGTGGAGATGG - Intergenic
951029837 3:17869342-17869364 CAGACTGGCTTAAGTAGAAAAGG + Intronic
951511354 3:23506341-23506363 TGGTCTGGCTGATGTAGAATGGG - Intronic
952152076 3:30604714-30604736 TTGGCTGGGTGAAGAAAAAAAGG + Intergenic
954307091 3:49733736-49733758 TGGGCTGGGGGAAGGAGGAATGG + Intronic
954996302 3:54885068-54885090 TGGGCTGAGTGAGGTAGAGATGG + Intronic
955641097 3:61085315-61085337 TAGGATGGCTAAAGTAAAAAAGG - Intronic
955870697 3:63435537-63435559 TGGGCTGGTTGAAGCAGAGAAGG + Intronic
956021807 3:64941149-64941171 TAGGTGGGCTGGAGTAGAAAAGG - Intergenic
956458946 3:69452332-69452354 TTGGCATGCTTAAGTAGAAAGGG + Intronic
958949601 3:100401790-100401812 TAGGTTGGCTGCAGTCGAAACGG + Exonic
959555547 3:107713026-107713048 TGGGCAGGCTGAATTTGAAGTGG - Intronic
959745639 3:109773706-109773728 TGGGCTTTCTCAAGTAGAAGGGG + Intergenic
960249401 3:115435669-115435691 TGGACTGGATGAGGAAGAAATGG + Intergenic
960306972 3:116073865-116073887 TTGGCTGTCTTATGTAGAAAAGG + Intronic
960549084 3:118953535-118953557 TGGCATGGATGAGGTAGAAAGGG - Intronic
960549210 3:118954909-118954931 TGGCATGGATGAGGTAGAAAGGG + Intronic
960705250 3:120475257-120475279 TAGTCTGGCTGGAGTAGACAAGG + Intergenic
961207980 3:125102515-125102537 TGGGCAGCATGAAGGAGAAATGG + Intronic
963922896 3:150923182-150923204 TGGGATGGCTAATGTAAAAAGGG - Intronic
964922216 3:161911018-161911040 TTTACTGGCTGAAGAAGAAAGGG - Intergenic
966923825 3:184631599-184631621 AGCGCTGGCTGGAGGAGAAATGG + Intronic
967433730 3:189419874-189419896 TGTGCTGGCTGAAGATGAAGGGG + Intergenic
968283538 3:197494862-197494884 TTGGCTGACTTAAGCAGAAAAGG - Intergenic
968905267 4:3447898-3447920 TGATCCGGCTGAAGAAGAAAGGG + Exonic
969855924 4:9999614-9999636 TGGGCTGGATGAAGTTGGAGGGG + Intronic
970246834 4:14072700-14072722 TGGGCTGGCTACTGTAGATAAGG - Intergenic
971105664 4:23521975-23521997 TGGGCTGGATGTTATAGAAAAGG - Intergenic
972044664 4:34650324-34650346 TGGGCTTGCAGAATTAGAAAAGG - Intergenic
974768332 4:66377849-66377871 TGGTCTGGCTGATATAGAAAAGG + Intergenic
974910914 4:68118636-68118658 TTTGCTGGCTGAAGGTGAAATGG + Intronic
976978343 4:91191868-91191890 CTGGCTGATTGAAGTAGAAAAGG - Intronic
977103712 4:92852539-92852561 TGGGGTCACTGAAGCAGAAATGG - Intronic
977698070 4:99989588-99989610 GGGGCTGGGGGAAGTAGGAATGG - Intergenic
978349012 4:107801755-107801777 TGGGCTGGCTGGAATGGGAATGG - Intergenic
978840664 4:113208309-113208331 TGGTCTGGATGATGGAGAAAAGG + Intronic
980907423 4:138961943-138961965 TGGGCTCCTTGAAGAAGAAAAGG - Intergenic
981261288 4:142722213-142722235 TAGGCTGGCTAAGGGAGAAAGGG + Intronic
982320018 4:154067823-154067845 TGGGCTTGGTGAAATAAAAATGG + Intergenic
984088994 4:175346933-175346955 TGGGAAGGTTGCAGTAGAAAAGG + Intergenic
986068143 5:4256110-4256132 TGGGCTGGCTGGAGCAGGGAGGG - Intergenic
987377052 5:17245732-17245754 TGGAGTGGCTGAAGGAAAAATGG + Intronic
992562481 5:77966221-77966243 TGGGATTTCTCAAGTAGAAAAGG + Intergenic
993568524 5:89506427-89506449 TGGGATGGCAGAAGTAGGCATGG - Intergenic
995866325 5:116695537-116695559 TGGCCAGGCTGGAGTACAAATGG - Intergenic
996873066 5:128213332-128213354 TCTGGTAGCTGAAGTAGAAATGG + Intergenic
997899886 5:137754545-137754567 TGGGCTGGCAGAAGCGGAAGCGG - Intergenic
998218013 5:140252134-140252156 TCGTGTGGCTAAAGTAGAAATGG - Intronic
999744995 5:154585074-154585096 TAGGATGGCAGAAGTAGAAGAGG - Intergenic
1000152001 5:158512215-158512237 TGCGCTGATTGAAGCAGAAATGG + Intergenic
1002075520 5:176706040-176706062 TGGGCTGGCTGAAGGATTCATGG - Intergenic
1002798442 6:496452-496474 TGGGCTGGCTGGAGTGGAGTCGG + Intronic
1005160216 6:22851036-22851058 TGGGTAGGCTGAGGTAGAAGAGG - Intergenic
1005730915 6:28695912-28695934 TGGATTGGCTGAAGGAAAAATGG + Intergenic
1006993222 6:38233493-38233515 TGTGCTGGATGCAGTAGAATGGG - Intronic
1007163461 6:39811444-39811466 TGGCCTGCCTGAAGGAGAACAGG - Intronic
1007176347 6:39900270-39900292 TGGGCTGTCTGTGGTAGGAATGG - Intronic
1007321122 6:41029298-41029320 TGGGAGGGGTGAACTAGAAAGGG - Intronic
1009501825 6:64423359-64423381 TTAGCTGGCTGAATTTGAAATGG - Intronic
1010175772 6:73026332-73026354 CGGGCTGGCTGAAGTAGACTGGG - Intronic
1010323254 6:74538009-74538031 GGGGGTGGCTCAAGGAGAAAAGG - Intergenic
1010784653 6:79986157-79986179 TGGGCTTGGAGAATTAGAAAGGG + Intergenic
1013469380 6:110448170-110448192 TGGGCTGGCTATAATAAAAAAGG - Intronic
1013576417 6:111487324-111487346 TGGGCTGGTTGAAGCAAAAAGGG - Intergenic
1014945936 6:127497562-127497584 TGGCCTGTTTGAAGTAGGAAAGG - Intronic
1015185423 6:130410203-130410225 TGGTCTGGCTGATTTAGGAAGGG + Intronic
1015710321 6:136132192-136132214 GGGGCTGGGGGAAGTGGAAATGG - Intronic
1017867589 6:158457339-158457361 TGTGCTGGCTGATGCAGAAGAGG - Intronic
1018773664 6:166994594-166994616 AGGGGTGGCAGAAGTAGAAGAGG + Intergenic
1018831249 6:167445364-167445386 GGGTATGGCTGAAGTAGACAGGG - Intergenic
1019009732 6:168834384-168834406 TGGGCAGGGTGAAGCAGACACGG - Intergenic
1019388465 7:772007-772029 TGGCTCTGCTGAAGTAGAAATGG + Intronic
1023908020 7:44536001-44536023 TGGCCTGGCTGAAGCAGGCACGG - Intronic
1023932169 7:44712640-44712662 GGGGCTGGGTGGAGAAGAAAAGG - Intergenic
1024628141 7:51225934-51225956 TGGTCAGGCTGAGGTAGACAGGG + Intronic
1028169324 7:87577049-87577071 TGGGGTGGCAGAGGTAGAAGTGG - Intronic
1028608467 7:92681632-92681654 TGAGTTGGCTGAAGTACAACTGG + Intronic
1028860399 7:95642517-95642539 TGGGCTGGCAAAAGAAGAATTGG + Intergenic
1029230548 7:99064478-99064500 AGGGCTGATTGAAGAAGAAATGG - Intronic
1029262932 7:99315594-99315616 TGGGCTTGCTGTATTAGACATGG + Intergenic
1030852616 7:114509468-114509490 TAGGCTGGATGCAGTAGAAGTGG + Intronic
1031142040 7:117953439-117953461 TGGGCTGACTGAACAAGAGAAGG + Intergenic
1036662885 8:10719257-10719279 TGGGCTGAGAGCAGTAGAAATGG + Intergenic
1037060781 8:14506807-14506829 TGGGCTGCCTGAAGTCAAACAGG - Intronic
1038616595 8:29101437-29101459 TGGGCTGCTTGACGTAGAATTGG + Intronic
1039556676 8:38481385-38481407 TGGGCTGGCAGAACTGGAACCGG - Intergenic
1039563098 8:38528803-38528825 TGGGCTGCCAGAAAGAGAAAGGG - Intergenic
1040530143 8:48260405-48260427 TGGTTTAGCTGAAGTAGGAATGG - Intergenic
1041667380 8:60458931-60458953 TGAGCTGGCTTAAGCAAAAAGGG - Intergenic
1042898409 8:73695693-73695715 TGGGCTCCCTGAAGTAGATCCGG - Intronic
1043318354 8:78949369-78949391 TGGAATGGCTGTAATAGAAATGG - Intergenic
1043540067 8:81251845-81251867 TGGGCTGTGGGAAGGAGAAATGG + Intergenic
1044700569 8:94962151-94962173 TGGGCAGGAAGAAGTAGAAAGGG - Intronic
1046521559 8:115332203-115332225 TTGGCTTGTTTAAGTAGAAATGG + Intergenic
1047470822 8:125170444-125170466 TGGGCAGGCTGGAGTGCAAATGG + Intronic
1049515866 8:143055006-143055028 TGGGCTGATTGACGTAGACATGG - Intronic
1049613890 8:143568041-143568063 TGGTTTGGCTGCAGTAGAAACGG + Intronic
1049708210 8:144052386-144052408 TGGGCAGGCTGGAGTAGGAGCGG - Intronic
1050124399 9:2341794-2341816 TGGACTGGATGAACTAGAAGTGG + Intergenic
1050470029 9:5978588-5978610 CTGGCTAGCTGAAGCAGAAAAGG + Intronic
1052237463 9:26228941-26228963 TGGGAAGGTTGAAGAAGAAAGGG + Intergenic
1052245042 9:26324226-26324248 TGGGAAGGCTAATGTAGAAAAGG - Intergenic
1055693707 9:78860256-78860278 TGGCTTGGGTAAAGTAGAAATGG + Intergenic
1056894552 9:90531052-90531074 TGGGATGGCTGAGGTAGCACAGG - Intergenic
1057971903 9:99566813-99566835 TGGAGTGGCTGTGGTAGAAAAGG + Intergenic
1058739133 9:107924859-107924881 TGTGTTGGCAGAAGTAGAAACGG - Intergenic
1058829103 9:108799460-108799482 TGGGCTGGTAGAGGGAGAAAGGG - Intergenic
1060605690 9:124911861-124911883 TGGGCTGGCTGGTGTTGGAAAGG - Intronic
1185701425 X:2233609-2233631 TGGACTGAATGAAGTTGAAATGG - Intronic
1185989278 X:4874995-4875017 TGGGCTGGGGGAAGAGGAAATGG + Intergenic
1186804636 X:13127728-13127750 TGAGCTGGCTCAAGGAGAAAAGG + Intergenic
1187391197 X:18887531-18887553 TTGGCTGGCTGAGGCACAAAGGG - Intergenic
1197390538 X:125858238-125858260 TGGGCTGACTTAAAGAGAAAGGG - Intergenic