ID: 1132248813

View in Genome Browser
Species Human (GRCh38)
Location 15:100318045-100318067
Sequence GGACATTTGCAGGACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 356}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132248807_1132248813 -6 Left 1132248807 15:100318028-100318050 CCATTACAAAGCCCCAGGGACAT 0: 1
1: 0
2: 1
3: 11
4: 166
Right 1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG 0: 1
1: 0
2: 1
3: 36
4: 356
1132248805_1132248813 -2 Left 1132248805 15:100318024-100318046 CCTGCCATTACAAAGCCCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 138
Right 1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG 0: 1
1: 0
2: 1
3: 36
4: 356
1132248802_1132248813 28 Left 1132248802 15:100317994-100318016 CCAGAGGGACTGAGGGCCTGTCT 0: 1
1: 0
2: 3
3: 33
4: 372
Right 1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG 0: 1
1: 0
2: 1
3: 36
4: 356
1132248803_1132248813 12 Left 1132248803 15:100318010-100318032 CCTGTCTTGAAAGTCCTGCCATT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG 0: 1
1: 0
2: 1
3: 36
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132248813 Original CRISPR GGACATTTGCAGGACATGGA AGG Intronic
900229225 1:1547889-1547911 GGACTTCTGCAGGACCTGGGCGG - Intronic
900338481 1:2176436-2176458 GGATGTTTCCAGCACATGGAGGG + Intronic
900798180 1:4722066-4722088 GGACAGTTGCATCACATTGAGGG + Intronic
901063512 1:6484716-6484738 GGACAGAGGCAGGACATGGTGGG - Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
908233033 1:62124687-62124709 GGACATCTGCAAGCCAAGGAGGG - Intronic
910136045 1:83971149-83971171 GGATATGGGCAGGACATTGAAGG + Intronic
910612599 1:89161086-89161108 GATCATTTGCAGGGTATGGATGG - Intronic
911133659 1:94417146-94417168 GGACATTTTCATTACCTGGAGGG - Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
914504157 1:148274378-148274400 GGACTTTGGCAGGACAAGGCAGG + Intergenic
916244672 1:162675395-162675417 GGACGATGGCGGGACATGGAAGG + Intronic
916247286 1:162701327-162701349 TGGCATTTGCAGTAAATGGAAGG + Intronic
917450215 1:175141733-175141755 GGACATTTTGATGAGATGGATGG + Intronic
917773781 1:178311095-178311117 GGACATCTGGAGGAGATGAATGG + Intronic
917842857 1:178996093-178996115 TAACATTTGCAGGACAGGCATGG - Intergenic
919126883 1:193405498-193405520 GAACATATGCATGACATGGATGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919539717 1:198831430-198831452 GGACATTAAGAGGACATTGAGGG - Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921926440 1:220713574-220713596 GGAAATGTGAAGGACATGGCCGG - Intergenic
924438669 1:244068546-244068568 GCACATTTGGAGAACAAGGAGGG - Intergenic
924625856 1:245695986-245696008 GGGTATTGGCAGGAGATGGAGGG + Intronic
924697899 1:246419359-246419381 GGACATCGGGAGGACGTGGAGGG - Intronic
1063039105 10:2318505-2318527 GGACCTTGGGAGGACATAGAGGG + Intergenic
1063602192 10:7492389-7492411 TGACATTTTCAGTGCATGGATGG - Intergenic
1066821478 10:39496823-39496845 GGACATTTGAAGGACTTTGAGGG + Intergenic
1066823434 10:39527805-39527827 GGACATTTGGAGCACTTTGAGGG + Intergenic
1066823478 10:39528489-39528511 GGACATTTGGAGCACTTTGAGGG + Intergenic
1066823530 10:39529505-39529527 GGACATTTGGAGCGCATTGAGGG + Intergenic
1066823599 10:39530873-39530895 GGACATTTGGAGCACTTTGAGGG + Intergenic
1067705020 10:48600128-48600150 GGACATTTGCATGTAATGGAAGG + Intronic
1067775597 10:49162874-49162896 GGACATGAGGAGGCCATGGATGG - Intronic
1068251514 10:54448505-54448527 GTACATTAGGAGGAGATGGAGGG - Intronic
1070249370 10:74760582-74760604 GTACATGTGCAGGATATGCAGGG - Intergenic
1071810103 10:89170153-89170175 GAAGATTTGCAGGGCATCGAGGG + Intergenic
1072062204 10:91824329-91824351 GGGCATTTGCTAGCCATGGAAGG + Intronic
1072245815 10:93542933-93542955 GCAGATTTGCAGGAGAGGGAAGG + Intergenic
1072738842 10:97897296-97897318 GGCCACTTGAAGGACAAGGAAGG - Intronic
1073292555 10:102420451-102420473 GGACCTTTGGAGGAAATGAAAGG + Exonic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074393128 10:113074429-113074451 TGACATTAGCAAGATATGGAAGG - Intronic
1074451987 10:113566897-113566919 GGAGATTTGTAGGTCATGGCAGG + Intronic
1074671362 10:115795949-115795971 GGGCATTAGCAGGATAAGGAGGG - Intronic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075987415 10:126799732-126799754 GGACAATTGCAAGAGAGGGAGGG - Intergenic
1077356526 11:2121414-2121436 GGGCATTGGCAGGACGTGGGTGG - Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079704577 11:23598233-23598255 GTGAATTTGCAGGATATGGAAGG + Intergenic
1080534403 11:33207619-33207641 AGACATTTCCAGGAGATGGAGGG - Intergenic
1082369623 11:51777464-51777486 GGACATTTGGAGGGCTTTGAGGG + Intergenic
1082393107 11:52119325-52119347 GGACATTTGGAGGGCTTTGAGGG + Intergenic
1082472454 11:53267246-53267268 GGACATTTGGAGGGCTTTGAGGG + Intergenic
1082543628 11:54295574-54295596 GGACATTTGGAGGGCTTTGAGGG + Intergenic
1082978379 11:59097918-59097940 GCACATTTGGAGGCCAAGGACGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085161491 11:74351411-74351433 GGACATTTGCAGGAGATACATGG - Exonic
1086498486 11:87427834-87427856 GGAAAGTTGCAGAAGATGGAGGG + Intergenic
1087816454 11:102664098-102664120 GGACATCGAGAGGACATGGAGGG + Intergenic
1087964699 11:104398220-104398242 GGACAGTAGCAGGACATGGGCGG - Intergenic
1089003695 11:115073327-115073349 AGACATTTGCAAGACAAGAAGGG - Intergenic
1089981549 11:122776924-122776946 GGGGATTTGGAGCACATGGAGGG + Intronic
1090562842 11:127951247-127951269 GGAGATTTGGTGAACATGGATGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091316075 11:134614996-134615018 GTCCATTTGCAGGGCATGGCAGG + Intergenic
1091997939 12:5009943-5009965 GGACATTTGTGGGACAGGGAGGG - Intergenic
1092340446 12:7671590-7671612 GCACTTTTGGAGGCCATGGAGGG - Intergenic
1092878443 12:12868657-12868679 GGATATTTGCAATTCATGGATGG - Intergenic
1094361722 12:29638312-29638334 AGACACTGGCAGGACATTGATGG + Intronic
1095367631 12:41427049-41427071 AAACATTTGCAGAACTTGGATGG + Intronic
1095956168 12:47807601-47807623 GGACACATGCAGGACCTAGATGG + Intronic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1097942363 12:65325346-65325368 GGATCTTTGCAGGCCAGGGAAGG + Intronic
1102278582 12:111600522-111600544 GGACAGTTCTAGGACATTGAGGG - Intergenic
1102514226 12:113435572-113435594 GGACATTTGTAGGGGCTGGAGGG + Intronic
1102732555 12:115125779-115125801 AGACACTTGCAGGACATCGGAGG + Intergenic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104710425 12:130982023-130982045 GGACAATTCCATGACATGGGAGG + Exonic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1106592444 13:31109495-31109517 GGAAATTTGCTGTGCATGGAAGG - Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116169407 14:41380725-41380747 GGACATTGGCAAGGCATGGGGGG - Intergenic
1116362106 14:44013070-44013092 GGACTTTGGGAGGACAAGGAGGG + Intergenic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1121783054 14:96634821-96634843 GGAGATTTGAATGTCATGGATGG + Intergenic
1122079130 14:99254654-99254676 GGACAATAGCAGGTCATGGAGGG + Intronic
1123036782 14:105474857-105474879 GGGCATTTGGAGGCCATGGTCGG - Intronic
1202914467 14_GL000194v1_random:153486-153508 GGAAATTTGAATGACATGGGAGG - Intergenic
1202875718 14_GL000225v1_random:208010-208032 GGAAATTTGAATGACATGGGAGG + Intergenic
1202878202 14_KI270722v1_random:29226-29248 GGAAATTTGAATGACATGGGAGG + Intergenic
1123387758 15:19834059-19834081 GGACATTTGGAGTACTTTGAGGG - Intergenic
1123939344 15:25209285-25209307 GGAGGTGTGCAGGGCATGGATGG + Intergenic
1123939753 15:25211104-25211126 GGACATGTGTGGGGCATGGATGG + Intergenic
1123942106 15:25221652-25221674 GGAGGTGTGCAGGGCATGGATGG + Intergenic
1123945989 15:25239149-25239171 GGAGGTGTGCAGGGCATGGATGG + Intergenic
1128749010 15:70135136-70135158 GGGCATTTGCAGGATAAAGAGGG - Intergenic
1129044430 15:72721008-72721030 GGACATTTAAAGGACAAGAAAGG + Intronic
1129779740 15:78262839-78262861 GGGCATGTGCAGGAGAGGGATGG - Intergenic
1130902948 15:88220676-88220698 GGCCATGTGCAGGAAATGGCTGG - Intronic
1131614933 15:94006190-94006212 GGACAGAAACAGGACATGGACGG + Intergenic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1135156964 16:20060882-20060904 CGAAATCTGAAGGACATGGAAGG - Intronic
1135580607 16:23622968-23622990 TGACGTTTGCAGAAGATGGAGGG - Exonic
1138123244 16:54417628-54417650 GGAAATTTTAAGGACATTGATGG + Intergenic
1141260244 16:82446909-82446931 TGGCATTTGCAGCACCTGGATGG + Intergenic
1141386687 16:83627911-83627933 AGACTTTTCCAGGAAATGGATGG + Intronic
1141396190 16:83707071-83707093 GGACATTTGCAGGACTAAGAAGG + Intronic
1143424227 17:6820996-6821018 GGAAATTAGAAGGAAATGGAGGG - Intronic
1144057783 17:11557826-11557848 GGACATCTGGATGACATTGAGGG - Exonic
1145685906 17:26663679-26663701 GGACATTTGGAGGGCTTCGAGGG + Intergenic
1145688554 17:26705501-26705523 GGACATTTGGAGGTCTTTGAGGG + Intergenic
1145932678 17:28697260-28697282 TAACATTTGGAGGACACGGAAGG - Intronic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1147996195 17:44361759-44361781 GTTCATTTGTAAGACATGGAAGG - Intronic
1149276747 17:55049095-55049117 CAACATTTTCAGGACATGAAAGG + Intronic
1149535368 17:57429539-57429561 GGACATTTGCAGCGCATTGAAGG + Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152241173 17:79161972-79161994 GGACTTTTGGGGGACAGGGATGG + Intronic
1152335229 17:79696815-79696837 GGACATGGACAGGACGTGGAGGG + Intergenic
1152809052 17:82372445-82372467 GCACATTTCCAGGCCCTGGAAGG + Intergenic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154534416 18:15384890-15384912 GGACATTTGGAGTACTTTGAGGG + Intergenic
1155280259 18:24232077-24232099 GGACATTTTCAGAACATGCCTGG - Intronic
1155806398 18:30175801-30175823 GGACATTGAGAGGACATCGAGGG - Intergenic
1157941879 18:51938029-51938051 ATACATTTGCAGGACCTGCAGGG + Intergenic
1158878133 18:61752256-61752278 GGACAGTGGCAGGTGATGGAGGG - Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1163110179 19:15155633-15155655 GCACATTGGCAGGCCAAGGAGGG + Intergenic
1164342585 19:24421968-24421990 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164342775 19:24424864-24424886 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164342965 19:24427760-24427782 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164343155 19:24430656-24430678 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164343348 19:24433552-24433574 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164343526 19:24436276-24436298 GGACATTTGGAGCACATTGAGGG + Intergenic
1164343710 19:24439170-24439192 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164343897 19:24442065-24442087 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164344094 19:24445131-24445153 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164344291 19:24448198-24448220 GGACATTTGGAGCGCATTGAGGG + Intergenic
1164345616 19:27252208-27252230 GGACATTTGGAGCACTTTGACGG + Intergenic
1164346064 19:27259310-27259332 GGACATTTGGAGCACTTTGAGGG + Intergenic
1164346236 19:27262896-27262918 GGACATTTGAAGCACTTTGAGGG + Intergenic
1164346390 19:27266102-27266124 GGACATTTGGAGCACTTTGAGGG + Intergenic
1164346725 19:27272489-27272511 GGACATTTGGAGCACTTTGAGGG + Intergenic
1164346885 19:27274963-27274985 GGACATTTGGAGCACTTTGAGGG + Intergenic
1164347091 19:27279379-27279401 GGACATTTGTAGCACTTTGAGGG + Intergenic
1164349264 19:27314483-27314505 GGATATTTGCAGCCCTTGGAGGG + Intergenic
1164649294 19:29880513-29880535 GCACATTTGAAGGTAATGGAAGG - Intergenic
1164695802 19:30242546-30242568 GGAGATTTCCTGGTCATGGATGG - Intronic
1165318758 19:35073657-35073679 GGGCATCTGCAGGGCATGGCTGG - Intergenic
1166125657 19:40714307-40714329 GGACATTCGCAGGGCACGGGAGG - Exonic
1166253127 19:41585078-41585100 GCACATGTGCAGGACACTGAGGG - Intronic
1166342261 19:42145530-42145552 GGACATTTGAAGGAAAGTGAGGG + Intronic
1166410955 19:42555131-42555153 GCACATGTGCAGGACACTGAGGG + Intronic
1167493245 19:49803638-49803660 GGACGATGGCAGGACACGGAAGG - Intronic
1167572531 19:50298029-50298051 GAACATGTGCAGTACCTGGAGGG - Intronic
1202672475 1_KI270710v1_random:3700-3722 GGAAATTTGAATGACATGGGAGG - Intergenic
931868806 2:66438447-66438469 GGACAGTTGCAGGTCAAGCAAGG + Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933783627 2:85820007-85820029 GCACAGTTGCATGACATGAAGGG + Intergenic
935627380 2:105182536-105182558 AGTCATTTGCACCACATGGATGG - Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
938533259 2:132213942-132213964 GGACATTTGGAGTACTTTGAGGG + Intronic
938598872 2:132816952-132816974 AGACATTTGCAGTTCAAGGAAGG - Intronic
939564984 2:143776181-143776203 GGAGATTTGGAGCACAAGGAGGG - Intergenic
940270972 2:151889719-151889741 GCACATTTGCAAGAAAGGGAGGG - Intronic
940527660 2:154838043-154838065 AGACATTTACAGTACATAGAAGG + Intronic
942571890 2:177323316-177323338 GGAGATTTGGAAGACATGAATGG - Intronic
943375255 2:187068543-187068565 GGGCATATGCTGGACATTGAAGG + Intergenic
946537016 2:220641962-220641984 GGATATTTGCAGGACAAAGATGG - Intergenic
947549532 2:231036883-231036905 GGCCAGATGCAGGACACGGATGG - Intergenic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
1169132112 20:3171690-3171712 GGACACCGGCAGGACAAGGAAGG + Intronic
1170243527 20:14195658-14195680 GGACATTGAGAGGACATTGAGGG + Intronic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1170775737 20:19373290-19373312 GGACCTGGGCAGGACAAGGAAGG - Intronic
1171207331 20:23291102-23291124 GGCCATTTGTAGGACAAGGACGG - Intergenic
1172312463 20:33929185-33929207 GGCCATTTGCAAGCCAAGGAGGG - Intergenic
1172916194 20:38445689-38445711 GCAGAGTTGCAGGACAGGGATGG + Intergenic
1173159528 20:40642029-40642051 GCAGATTTGCAGGGCCTGGAAGG - Intergenic
1173376864 20:42493338-42493360 GGAAATTTGGAGGACTTTGAGGG + Intronic
1176040201 20:63061116-63061138 GGACACGGACAGGACATGGAGGG - Intergenic
1176633821 21:9168131-9168153 GGAAATTTGAATGACATGGGAGG - Intergenic
1176639506 21:9286691-9286713 GGAAATTTGAATGACATGGGAGG + Intergenic
1176916789 21:14635305-14635327 ATACATGTGCAGGACATGCAGGG - Intronic
1179410128 21:41156120-41156142 GGCTCTTTGCAGGATATGGATGG + Intergenic
1179635959 21:42709421-42709443 ATACATGTGCAGGACATGCAGGG - Intronic
1180348520 22:11776066-11776088 GGAAATTTGAATGACATGGGAGG + Intergenic
1180372807 22:12059520-12059542 GGAAATTTGAATGACATGGGAGG + Intergenic
1180389675 22:12216145-12216167 GGAAATTTGAATGACATGGGAGG - Intergenic
1180416260 22:12718337-12718359 GGAAATTTGAATGACATGGGAGG + Intergenic
1180423551 22:12894159-12894181 GGAAATTTGAATGACATGGGAGG + Intergenic
1180510389 22:16080110-16080132 GGACATTTGGAGTACTTTGAGGG - Intergenic
1181915161 22:26273978-26274000 TGAGAATTGCAGGACTTGGAGGG - Intronic
1184320920 22:43741719-43741741 GGACAGTGGCAGGACAGGGAAGG - Intronic
1185034063 22:48461662-48461684 GGACCTCCGCAGGACAGGGAAGG + Intergenic
949893715 3:8753392-8753414 GGGCATGTCCAGGACAAGGAGGG - Intronic
951038131 3:17956356-17956378 GGAGATAGGAAGGACATGGAGGG - Intronic
952815451 3:37443295-37443317 GAAATTTTGCAGGAAATGGAAGG - Intergenic
954736606 3:52712804-52712826 GGACATTGAGAGGACATCGAGGG - Intronic
955192164 3:56771551-56771573 GGACATTTGTAGGTGATGGTTGG + Intronic
955848027 3:63188548-63188570 GAACATTTTCAGCACATTGAAGG - Intergenic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
959692758 3:109217542-109217564 GGACAGATGCAGAACATGCAAGG - Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
961425201 3:126839904-126839926 GGACATTTTCATCACCTGGATGG + Intronic
961955592 3:130799691-130799713 GCACTTTTGCAGGCCATGGCGGG + Intergenic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963534650 3:146512735-146512757 GGAGAGAGGCAGGACATGGAGGG + Intergenic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
964709634 3:159657989-159658011 GAACATTTGCCGGACATCAATGG - Intronic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
1202747388 3_GL000221v1_random:118336-118358 GGAAATTTGAATGACATGGGAGG - Intergenic
971402598 4:26290081-26290103 GGACTTTGGGAGGACATGGTGGG + Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
975161775 4:71132939-71132961 GAACATGTGGAGGACATGGTGGG + Intergenic
978307253 4:107343905-107343927 TGACATTTCCAGCACATGGTTGG + Intergenic
979489305 4:121306980-121307002 GGACATTTTCAGTACCTAGAGGG - Intergenic
983489905 4:168376672-168376694 GCACAATGGCAGGACATGGAAGG - Intronic
983809721 4:172045998-172046020 TGCTATTTGCAAGACATGGATGG - Intronic
984163134 4:176278154-176278176 GAACATTTGCAGCATATGAAAGG + Intergenic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
1202754394 4_GL000008v2_random:45082-45104 GGAAATTTGAATGACATGGGAGG + Intergenic
985768653 5:1795553-1795575 GGACATTGGCAAGACAGGGCTGG + Intergenic
985957064 5:3273774-3273796 GGCCATGTGCAGGACCTGGTGGG - Intergenic
986374357 5:7115008-7115030 GGAGAATAGCAGGACAGGGAAGG + Intergenic
988290220 5:29274825-29274847 GGACATTTTCACGATATTGATGG - Intergenic
989598664 5:43181650-43181672 AGACATTTGCAGGAGAGGGCCGG + Intronic
989774020 5:45181118-45181140 AGACATAAGCAGGACAGGGAGGG - Intergenic
989858858 5:46339377-46339399 GGACATTTGGAGCACTTTGAGGG - Intergenic
989858981 5:46341591-46341613 GGACATTTGGAGCACTTTGAGGG - Intergenic
989859945 5:46358967-46358989 GGACATTTGGAGTACTTTGAGGG - Intergenic
989860233 5:46364398-46364420 GGACATTTGGAGCACTTTGAGGG - Intergenic
989860560 5:46370963-46370985 GGACATTTGGAGCACTTTGAGGG + Intergenic
989862239 5:46391643-46391665 GGATATTTGGAGCACTTGGAGGG + Intergenic
989862485 5:46396485-46396507 GGACATTTGGAGGACTTAGTGGG + Intergenic
989863522 5:46416036-46416058 GGACATTTGGAGCGCTTGGAGGG + Intergenic
989863617 5:46418015-46418037 GGACATTTGGAGCACTTTGAGGG - Intergenic
989896115 5:47086541-47086563 GGACATTTGGAGCACTTTGAGGG - Intergenic
989896332 5:47090778-47090800 GGACATTTGGAGCACTTTGAGGG - Intergenic
989896729 5:47098485-47098507 GGACATTTGGAGCACTTTGAGGG - Intergenic
989896773 5:47099338-47099360 GGACATTTGGAGCACTTTGAGGG - Intergenic
989896926 5:47102278-47102300 GGACATTTGGAGCACTTTGAGGG - Intergenic
989912168 5:49669345-49669367 GGACATTTGGAGCGCATTGAGGG + Intergenic
989912354 5:49672243-49672265 GGACATTTGGAGCGCATTGAGGG + Intergenic
989912539 5:49675139-49675161 GGACATTTGGAGCGCATTGAGGG + Intergenic
989912716 5:49678035-49678057 GGACATTTGGAGCGCATTGAGGG + Intergenic
989912900 5:49680932-49680954 GGACATTTGGAGCGCATTGAGGG + Intergenic
989913080 5:49683829-49683851 GGACATTTGGAGCGCATTGAGGG + Intergenic
989913248 5:49686552-49686574 GGACATTTGGAGCCCATTGAGGG + Intergenic
989913427 5:49689448-49689470 GGACATTTGGAGCGCATTGAGGG + Intergenic
989913621 5:49692346-49692368 GGACATTTGGAGCGCATTGAGGG + Intergenic
989913810 5:49695241-49695263 GGACATTTGGAGCACATTGAGGG + Intergenic
989913996 5:49698133-49698155 GGACATTTGGAGCGCATTGAGGG + Intergenic
989914179 5:49701029-49701051 GGACATTTGGAGCGCATTGAGGG + Intergenic
989914369 5:49703929-49703951 GGACATTTGGAGCGCATTGAGGG + Intergenic
989914557 5:49706827-49706849 GGACATTTGGAGCGCATTGAGGG + Intergenic
989914737 5:49709729-49709751 GGACATTTGGAGCACATTGAGGG + Intergenic
989914930 5:49712626-49712648 GGACATTTGGAGCGCATTGAGGG + Intergenic
989915122 5:49715519-49715541 GGACATTTGGAGCGCATTGAGGG + Intergenic
989922246 5:49821257-49821279 GGATATTTGGAGCACTTGGAGGG + Intergenic
989932498 5:49973527-49973549 GGATATTTGGAGCACTTGGAGGG + Intergenic
989946389 5:50235907-50235929 GGACATTTGGAGCACTTTGACGG - Intergenic
991394737 5:66192208-66192230 AGACATTTGCATTAAATGGATGG + Intergenic
992481080 5:77153008-77153030 GGATATTTGCAACACTTGGAGGG + Intergenic
992697820 5:79307981-79308003 GCACATTTGGAGGCCAAGGAGGG - Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995360855 5:111295304-111295326 AGAAATTTGTAGGATATGGAGGG - Intronic
996563854 5:124859002-124859024 GGACATTTGGAGGCAATGAAGGG - Intergenic
996795853 5:127345998-127346020 TGACATTTGCAGCACCTGGATGG - Intronic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1001190408 5:169625363-169625385 GGACATTTGCAGTTCATGAGAGG + Intergenic
1202771641 5_GL000208v1_random:7168-7190 GGACATTTGGAGCACTTTGAGGG - Intergenic
1202771793 5_GL000208v1_random:10226-10248 GGACATTTGGAGCACTTTGAGGG - Intergenic
1202772009 5_GL000208v1_random:14136-14158 GGACATTTGGAGCACTTTGAGGG - Intergenic
1202772404 5_GL000208v1_random:21845-21867 GGACATTTGGAGCACTTTGAGGG - Intergenic
1202772448 5_GL000208v1_random:22699-22721 GGACATTTGGAGCACTTTGATGG - Intergenic
1202772537 5_GL000208v1_random:24482-24504 GGACATTTGGAGCACTTTGAGGG - Intergenic
1202773815 5_GL000208v1_random:41426-41448 GGACATTTGGAGCACTTAGAGGG - Intergenic
1202773855 5_GL000208v1_random:42108-42130 GGACATTTGGAGCACTTTGAGGG - Intergenic
1202773867 5_GL000208v1_random:42449-42471 GGACACTTGCAGCACTTTGAAGG - Intergenic
1202773962 5_GL000208v1_random:44465-44487 GGACATTTGGAGCACTTTGAGGG - Intergenic
1202774263 5_GL000208v1_random:50438-50460 GGACATTTGGAGCACTTGGAGGG - Intergenic
1202774428 5_GL000208v1_random:53676-53698 GGACTTTTGGAGCACATTGAGGG - Intergenic
1202776145 5_GL000208v1_random:74994-75016 GGACATTTGGAGCACTTGGAGGG - Intergenic
1202776269 5_GL000208v1_random:77379-77401 GGACATTTGGAGCGCATTGAGGG - Intergenic
1202776394 5_GL000208v1_random:79593-79615 GGACATTTGGAGCGCATTGAGGG - Intergenic
1202776521 5_GL000208v1_random:81806-81828 GGACATTTGGAGCGCATTGAGGG - Intergenic
1202776653 5_GL000208v1_random:84021-84043 GGACATTTGGAGCCCATTGAGGG - Intergenic
1202776784 5_GL000208v1_random:86235-86257 GGACATTTGGAGCCCATTGAGGG - Intergenic
1004545354 6:16592915-16592937 GGACAGAAACAGGACATGGACGG - Intronic
1005678007 6:28175989-28176011 GCACTTTGGCAGGCCATGGAAGG - Intergenic
1006013836 6:31064952-31064974 GGACTTTTGGAGGACAAGGTGGG + Intergenic
1007397456 6:41585880-41585902 AGAGATTCGCAGGACAAGGAGGG - Intronic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008253619 6:49270961-49270983 GGACATTTGCTGAACATGTAAGG - Intergenic
1008674819 6:53808002-53808024 GGATATTGGCAGGGCCTGGAGGG + Intronic
1009390186 6:63135572-63135594 AGACATTTGCATGACAAAGATGG - Intergenic
1009894407 6:69729293-69729315 GGACATTTACAAGTCAGGGAAGG - Intronic
1012155840 6:95819285-95819307 AGAGTTTTGCAGGAGATGGAGGG - Intergenic
1013141429 6:107339737-107339759 GTATATTTGCAGCACAAGGAGGG + Intronic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1018967844 6:168502421-168502443 GGGCAGATGCAGGGCATGGAGGG - Intronic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1019980100 7:4615096-4615118 GGACATTTGGAGGGCAGAGAGGG - Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1024098271 7:46003855-46003877 GGACATTTGAAAGAGATGGGAGG + Intergenic
1024539637 7:50465841-50465863 GGACACATCCTGGACATGGATGG + Intronic
1025314765 7:58006834-58006856 GGACATTTGGAGTGCATTGAGGG + Intergenic
1025506480 7:61439066-61439088 GGACATTTGGAGCACTTTGAAGG + Intergenic
1025509070 7:61482839-61482861 GGACATTTGGAGCACTTTGAAGG + Intergenic
1025538470 7:62039955-62039977 GGACATTTGGAGCACTTTGAAGG + Intergenic
1027217981 7:76196474-76196496 GGACAGTCCCAGGAGATGGAAGG + Intergenic
1029294089 7:99525676-99525698 GGACTTTTACAGTACAGGGATGG - Intronic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1036014573 8:4768159-4768181 GAAAATTAGCAGGACATTGATGG + Intronic
1036457480 8:8922601-8922623 GGACAGGTGCCTGACATGGAAGG + Intergenic
1036962913 8:13265619-13265641 GGACATTTGCAGGAAGATGATGG - Intronic
1038400032 8:27277655-27277677 GGCCATCTGCAGTACCTGGAAGG - Intergenic
1038429110 8:27485644-27485666 GAAGATATGCTGGACATGGAAGG + Intergenic
1040763843 8:50882141-50882163 CGACATTTTCATGAGATGGAAGG + Intergenic
1040798103 8:51309610-51309632 GGACACGTGCAGGACATCGCAGG - Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1044326313 8:90862575-90862597 GGACATATGCAGGCTATTGAAGG + Intronic
1045900596 8:107274962-107274984 GCACAGTGGGAGGACATGGAAGG + Intronic
1046457651 8:114487996-114488018 TGACATTTGCAGCAATTGGATGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1049583794 8:143423908-143423930 TGACATTTGCAGGACAGGAAAGG - Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051558312 9:18410232-18410254 GTACATTTGCAGGATGTGCAGGG + Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053713465 9:40852342-40852364 GGACACTTGGAGGACTTTGAGGG + Intergenic
1053715337 9:40883276-40883298 GGACATTTGGAGCACTTTGAAGG + Intergenic
1053936311 9:43157543-43157565 GGACATTTGGAGTACTTTGAGGG + Intergenic
1053985815 9:43987762-43987784 GGACATTTGCAGCGCTTTGAGGG + Intergenic
1054077217 9:60547487-60547509 GGACATTTGGAGCACTTTGAAGG - Intergenic
1054423849 9:64982690-64982712 GGACACTTGGAGGACTTTGAGGG + Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1057323976 9:94043159-94043181 GGACATTTGCAATTCATGGGAGG - Intronic
1057348277 9:94271835-94271857 GGACTTTTGCAGGAAGTGTATGG + Intronic
1058094051 9:100838823-100838845 GGACATATGCAGGATTTGAAAGG - Intergenic
1058094856 9:100848103-100848125 GGACATTTGAAGGAATTTGAGGG - Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1061185057 9:129048231-129048253 GGTCATGAGCAGGACATGGAGGG + Intronic
1203756660 Un_GL000218v1:135775-135797 GGAAATTTGAATGACATGGGAGG - Intergenic
1203417863 Un_KI270362v1:1383-1405 GGACATTTGGAGCACTTAGAGGG - Intergenic
1203417900 Un_KI270362v1:2065-2087 GGACATTTGGAGCACTTTGAGGG - Intergenic
1203417913 Un_KI270362v1:2406-2428 GGACACTTGCAGCACTTTGAGGG - Intergenic
1203418027 Un_KI270366v1:1200-1222 GGACATTTGGAGCACTTGGAGGG - Intergenic
1203418191 Un_KI270366v1:4438-4460 GGACTTTTGGAGCACATTGAGGG - Intergenic
1203356176 Un_KI270442v1:148494-148516 GGACATTTGCAGCCCTTTGAGGG - Intergenic
1203375296 Un_KI270442v1:369185-369207 GGACATTTGGAGGGCTTTGAGGG - Intergenic
1203716024 Un_KI270742v1:148427-148449 GGAAATTTGAATGACATGGGAGG - Intergenic
1203535187 Un_KI270743v1:29809-29831 GGAAATTTGAATGACATGGGAGG + Intergenic
1203650263 Un_KI270751v1:111997-112019 GGAAATTTGAATGACATGGGAGG - Intergenic
1185859249 X:3562416-3562438 GGACATTTTCAGTAGATGAATGG - Intergenic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186977168 X:14919922-14919944 GGAAATATGCAGCACGTGGAGGG + Exonic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1189313952 X:40040487-40040509 GGACATTGTCAGGACTTGTATGG + Intergenic
1190684344 X:52857463-52857485 GGACGTTTGGAGGCCAAGGAGGG + Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195425319 X:104722795-104722817 GGACATACACAGGACATGCATGG + Intronic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1198964246 X:142210600-142210622 GGACATTGAGAGGACATCGAGGG + Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199064546 X:143399551-143399573 AGACAGTTGCAGAACATGGGAGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1200806793 Y:7442007-7442029 GGACATTTTCAGGAGATGAATGG + Intergenic