ID: 1132251109

View in Genome Browser
Species Human (GRCh38)
Location 15:100335987-100336009
Sequence GATCTTGGATGTGTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132251109_1132251114 5 Left 1132251109 15:100335987-100336009 CCCCATCACACACATCCAAGATC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 1132251114 15:100336015-100336037 GCTGCAGTATTTCAGAGTTCAGG 0: 1
1: 0
2: 1
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132251109 Original CRISPR GATCTTGGATGTGTGTGATG GGG (reversed) Intronic
900664158 1:3802896-3802918 GATGTTGAATGTGTGTGTTTTGG + Intergenic
901436655 1:9250814-9250836 CCACTTAGATGTGTGTGATGCGG - Intronic
903693992 1:25194316-25194338 GAGCATGGGTGTGTGTGCTGTGG - Intergenic
905145959 1:35886954-35886976 GTGTTTGGATGTGTGTGATGGGG + Intronic
905529841 1:38669147-38669169 GATTTTGGAGTTGTCTGATGTGG - Intergenic
906193059 1:43911096-43911118 GAGCTTGGATGTGTGGAGTGAGG + Intronic
907439995 1:54473110-54473132 GAGCTTGGATGTGGGGGCTGGGG + Intergenic
907817765 1:57937186-57937208 GATCTTGGGACTATGTGATGAGG + Intronic
909091218 1:71228329-71228351 GATTTTGGATCTGTGTGAAGGGG + Intergenic
910728446 1:90363275-90363297 GATCTTAGGTGAGGGTGATGGGG - Intergenic
913488164 1:119352974-119352996 GAAGTTGGATGGGTGAGATGTGG - Intergenic
914245078 1:145879503-145879525 GATCTAGGATGTGTGACTTGTGG - Intronic
915218702 1:154356827-154356849 GAACTTGGACTTGTGTGCTGGGG - Intergenic
917052908 1:170944324-170944346 TACTTTGTATGTGTGTGATGTGG - Intronic
918069313 1:181123217-181123239 GCTCTTGGGTGTGACTGATGAGG - Intergenic
920491474 1:206418971-206418993 TATGTTGGATGTGTGTGTGGTGG - Intronic
921065115 1:211617069-211617091 GATTTCTGATGTGTGTGGTGAGG + Intergenic
922677660 1:227562423-227562445 GATCCAGGGTGTGTGTGTTGGGG + Intergenic
922704208 1:227780438-227780460 GCTCTTGGGTGTGTGAGAGGGGG + Intronic
923185580 1:231569776-231569798 GATCTTGGGTGTGTCTGTGGGGG - Intronic
923419804 1:233801380-233801402 GCTCTTGTGTGTGTGTGTTGGGG - Intergenic
923518109 1:234714273-234714295 GATCTAGGAAAGGTGTGATGGGG + Intergenic
924934023 1:248752923-248752945 GATGTGGTGTGTGTGTGATGTGG - Intronic
1064977413 10:21133133-21133155 AATTTTGTATGTGTGTGAGGTGG + Intronic
1067944491 10:50681662-50681684 GATCTTGGGGGTGTGTCCTGGGG + Intergenic
1070144866 10:73766449-73766471 GATGATGGTTGTGTCTGATGTGG + Exonic
1070932052 10:80267909-80267931 GAGCTGGGGTGTGTGTGATAAGG - Intergenic
1071237528 10:83666657-83666679 GAGCTTGGAGAGGTGTGATGTGG + Intergenic
1071632891 10:87230754-87230776 GATCTTGGGGGTGTGTCCTGGGG + Intronic
1071646340 10:87362972-87362994 GATCTTGGGGGTGTGTCCTGGGG + Intronic
1071713771 10:88074746-88074768 CCTCTGGCATGTGTGTGATGGGG + Intergenic
1072845414 10:98825176-98825198 CTTTTTGGATGTGTGTGAGGTGG + Intronic
1075304306 10:121354370-121354392 GATCTGGGATGTGTGAGCTAGGG - Intergenic
1075694230 10:124421524-124421546 GGTCTTGGATGTCTGTTATGAGG - Intergenic
1075787758 10:125061535-125061557 GAACTGGGATGTGTGGGATTTGG - Intronic
1076315108 10:129534312-129534334 GATGTTGAAGGAGTGTGATGTGG + Intronic
1079529368 11:21431252-21431274 GATCGTGGGTGTCTGGGATGAGG - Intronic
1079657597 11:23002034-23002056 GAGCTTGGATGTTTATGCTGGGG + Intergenic
1079802318 11:24885552-24885574 GATATTGTATGGGTGAGATGAGG + Intronic
1081871048 11:46382609-46382631 GAACTGGGGTGCGTGTGATGGGG + Exonic
1083910778 11:65708209-65708231 GATCAGGGATGTGGGGGATGGGG + Intergenic
1084591552 11:70093516-70093538 ACTCTTGGCTGTGTGTGCTGGGG + Intronic
1084860031 11:72012196-72012218 GACCTGGGATGGGTGGGATGAGG + Intronic
1085129079 11:74022236-74022258 GATCTTGGCTGTGGGTCATGGGG + Intronic
1087075954 11:94127596-94127618 GCTCTTGGATGTGTGTTTAGCGG + Intergenic
1089174747 11:116540353-116540375 GTACTGGGATGTGTGTGATGGGG - Intergenic
1089832514 11:121341076-121341098 GAGCTTGTATGTGTGTGCAGTGG - Intergenic
1091026504 11:132146423-132146445 GAACGTGGATGTGTATGACGAGG + Exonic
1091130517 11:133143115-133143137 GATGTTGGATGGATGTGAGGAGG + Intronic
1092062234 12:5560869-5560891 GAAATTAGATGTGTGTGAGGGGG + Intronic
1092860025 12:12712331-12712353 GAGTTTGGATTTGTGAGATGGGG - Intergenic
1092903857 12:13084671-13084693 AATTCTGGATGTGTGAGATGTGG + Intronic
1092935384 12:13357601-13357623 GATCTTGGCTGTTTGTCTTGTGG + Intergenic
1093590249 12:20894415-20894437 GATGATGAATGTGTGTGATATGG - Intronic
1098476434 12:70909307-70909329 TATCTTTGATGTGTGTGTGGTGG - Intronic
1098776953 12:74632554-74632576 GATCTTTGAAGTTTTTGATGTGG + Intergenic
1098866182 12:75766526-75766548 GATTTGGGAGGTGTGGGATGGGG - Intergenic
1103571316 12:121846969-121846991 GGTCAGGGATGTGGGTGATGGGG - Intronic
1104548487 12:129733520-129733542 AATCTTGGCAGAGTGTGATGGGG - Intronic
1105344817 13:19561922-19561944 GTTCTTGAAATTGTGTGATGAGG - Intergenic
1106002420 13:25736800-25736822 GATCATGGGAGTGTGTGAGGGGG + Intronic
1110329822 13:74258665-74258687 GGAGTTGGATGTGTATGATGGGG + Intergenic
1112155344 13:96810753-96810775 GAGCTTGCATGTGTGTTAAGGGG + Intronic
1116229232 14:42194582-42194604 CATCTTTGATGTGTGTGTTTGGG - Intergenic
1117683991 14:58234795-58234817 GATTTTGGAAGTTTGTTATGTGG + Exonic
1121229071 14:92343029-92343051 GCGCAGGGATGTGTGTGATGGGG - Intronic
1123570629 15:21603747-21603769 GATGGTGGAGGTGTGGGATGTGG + Intergenic
1123606742 15:22039100-22039122 GATGGTGGAGGTGTGGGATGTGG + Intergenic
1123716361 15:23035711-23035733 CATCTTGGATGTGTTTGTTATGG - Intronic
1123756855 15:23403638-23403660 GATCTGGGCTGTGTCTGAAGCGG - Intergenic
1124611640 15:31213761-31213783 TAACGTGGATGTGTATGATGGGG + Intergenic
1124867699 15:33509455-33509477 TATTTTGTATGTGTGTGAGGAGG + Intronic
1125770616 15:42163210-42163232 GATCTTGCATGTGTGTATTGAGG - Intronic
1128691734 15:69729631-69729653 TATGTTGGATGTGTGTGAGGTGG - Intergenic
1130313881 15:82778799-82778821 GACCTTGGATTTCTCTGATGTGG - Exonic
1132251109 15:100335987-100336009 GATCTTGGATGTGTGTGATGGGG - Intronic
1132405430 15:101539304-101539326 GAACTTGGTTGTGTGCAATGGGG - Intergenic
1202978982 15_KI270727v1_random:330870-330892 GATGGTGGAGGTGTGGGATGTGG + Intergenic
1133121137 16:3608817-3608839 GATGATGGATGAGTCTGATGAGG - Exonic
1133427182 16:5702788-5702810 GATCTTTGCTGTGTGTGTTGTGG + Intergenic
1133828213 16:9297897-9297919 TATTTGGGATGTGTGTGCTGGGG + Intergenic
1135497648 16:22966454-22966476 GGTTTTGGATGTCAGTGATGAGG - Intergenic
1136028796 16:27487893-27487915 GATCTTGGCTAGTTGTGATGAGG + Intronic
1138267222 16:55668317-55668339 GATCTTTGATCTTTGTGGTGAGG + Intronic
1138401200 16:56745635-56745657 GATGTAGGATGTGAGTTATGGGG + Intronic
1139006149 16:62573744-62573766 TATCTTGGTTGTGTATGCTGTGG - Intergenic
1143065566 17:4244557-4244579 GATTTGGAATGTCTGTGATGTGG - Intronic
1145882871 17:28364761-28364783 GATGTTGGCTGTGTGAGAAGGGG + Intronic
1146662325 17:34673105-34673127 GATATTGGGCGTGTGTGGTGGGG + Intergenic
1148022381 17:44561986-44562008 GATCTTGGCTCTGTGTGCTTTGG + Intergenic
1148444506 17:47729341-47729363 GCTCTTGGATGGGTTTGGTGGGG - Intergenic
1148570780 17:48667184-48667206 AATTTTGGGTGTGTGTGGTGGGG + Intergenic
1148651860 17:49255879-49255901 CAACTTGAATGTTTGTGATGTGG + Intergenic
1150140482 17:62724486-62724508 GAAGTAGGATGTGTGTGCTGGGG + Intronic
1151534800 17:74732731-74732753 GATTTGAGGTGTGTGTGATGAGG + Intronic
1152201494 17:78949523-78949545 GATTTTGTGTATGTGTGATGGGG - Intergenic
1152234023 17:79129298-79129320 CATCCTGGATGTGTGTGCTTGGG - Intronic
1153224385 18:2887385-2887407 GATCTTCAATGTGGGAGATGGGG + Intronic
1155392651 18:25351992-25352014 GACCTTGCAGGTTTGTGATGAGG - Exonic
1157123976 18:44937735-44937757 GATTTTGGAAGTCTGAGATGGGG - Intronic
1157733699 18:50027534-50027556 ACTCTTGGTTGTGTGTGAGGTGG - Intronic
1157903313 18:51542024-51542046 GAGCTTAGAAGTGTGTGGTGGGG - Intergenic
1159233797 18:65644603-65644625 GTTCTTGGCTATGTTTGATGCGG - Intergenic
1165968455 19:39604740-39604762 GACCTTACATGTGGGTGATGTGG + Intronic
1166560065 19:43726898-43726920 GATTTTGGATTGGTGAGATGAGG + Intergenic
1166681160 19:44767972-44767994 GGTCTAGGCTGTGGGTGATGTGG + Intergenic
925866046 2:8226918-8226940 GCTCTTGTTTGTGTGGGATGAGG + Intergenic
926711607 2:15886611-15886633 GAGCTGGGAGGTTTGTGATGAGG + Intergenic
927384550 2:22518110-22518132 ATTCTTGGATGTGGATGATGGGG - Intergenic
930248158 2:49005843-49005865 GATCTTGGGTGTGTTTGAAAGGG + Intronic
930346089 2:50183140-50183162 GATTTTAGATGTGAGTGAAGAGG + Intronic
931181709 2:59908345-59908367 GTGCTTGGGTGTGTGTGTTGTGG - Intergenic
931243695 2:60475706-60475728 GATCTTGTTTGTGTGTAGTGGGG + Intronic
932320392 2:70818008-70818030 GATCATGGATGTGTGAGATTAGG - Intronic
936743897 2:115549944-115549966 GCTCAGGAATGTGTGTGATGTGG - Intronic
943986707 2:194631038-194631060 GTCTTTGGATGTGTGTGGTGGGG + Intergenic
946143580 2:217712399-217712421 TACTTTGGATGTGTGGGATGGGG - Intronic
948568630 2:238902198-238902220 GATATGGGGTATGTGTGATGTGG + Intronic
948568638 2:238902261-238902283 GAATTGGGGTGTGTGTGATGGGG + Intronic
948568678 2:238902670-238902692 GATGTGGGGTGTGTGTGATATGG + Intronic
948568687 2:238902765-238902787 GATGTGAGGTGTGTGTGATGTGG + Intronic
948568705 2:238902915-238902937 GATGTGAGGTGTGTGTGATGTGG + Intronic
948568713 2:238903002-238903024 GATGTGAGGTGTGTGTGATGTGG + Intronic
948568723 2:238903108-238903130 GATGTGAGGTGTGTGTGATGTGG + Intronic
948568754 2:238903419-238903441 GATGTGGGATGTGTGTGATGTGG + Intronic
948568780 2:238904071-238904093 GATGTGGGGTGTGTGTGATGTGG + Intronic
948568788 2:238904168-238904190 GATGTGAGGTGTGTGTGATGTGG + Intronic
948568792 2:238904214-238904236 GATGTAGTGTGTGTGTGATGTGG + Intronic
948568800 2:238904277-238904299 GATGTAGTGTGTGTGTGATGGGG + Intronic
948568812 2:238904422-238904444 GATGTGGGGTGTGTGTGATGTGG + Intronic
948973073 2:241444318-241444340 AACCTTGGATTTGTGTGCTGGGG + Intronic
948985217 2:241517711-241517733 TGTGTTGGATGTGTGTGTTGGGG - Intergenic
1170341787 20:15336844-15336866 GATATTGCATGTGTGAGGTGAGG + Intronic
1172620388 20:36314845-36314867 GTGCTATGATGTGTGTGATGTGG + Intronic
1173329309 20:42061160-42061182 CATCTGGGCTGTGTCTGATGGGG + Intergenic
1173809912 20:45949365-45949387 CATACTGGATGTGTGTGATCTGG + Exonic
1174420702 20:50397278-50397300 GATTTGGGATGTGTGGGGTGAGG - Intergenic
1175020790 20:55846665-55846687 GATCCGGGATGTGTGGAATGTGG - Intergenic
1177687309 21:24454164-24454186 GATCTTTGAACTGTATGATGTGG + Intergenic
1179469983 21:41603886-41603908 GTTCTTGGAGGGGTGGGATGGGG - Intergenic
1179942953 21:44651346-44651368 GAAGTTGGATGTGTGTCCTGTGG + Intronic
1182705133 22:32272219-32272241 GATCATGGATGTGACTGAGGTGG + Intergenic
1183268259 22:36844306-36844328 GATCTTGAGGGAGTGTGATGGGG - Intergenic
950627012 3:14254601-14254623 TATCTTGTGTGTGTGTGTTGGGG + Intergenic
951745093 3:25969567-25969589 GATTTTGTATGTGTGTAAGGTGG + Intergenic
951983622 3:28593468-28593490 GTCCTTGGCAGTGTGTGATGAGG + Intergenic
953411756 3:42694278-42694300 TTGCTTGGATGTGGGTGATGAGG - Intronic
956069374 3:65431611-65431633 GATTTTGTGTGTGTGTGTTGTGG - Intronic
956280395 3:67550281-67550303 GATCTTAGATGTTGGTGTTGGGG - Intronic
957566185 3:81887148-81887170 CATCTTGTAATTGTGTGATGAGG + Intergenic
959189236 3:103088836-103088858 GAACTGGGATTTATGTGATGAGG + Intergenic
961564906 3:127756495-127756517 GATCGGGGATGGGTGAGATGGGG - Intronic
962508826 3:136077695-136077717 GATTGAGGATGTGTGTGCTGTGG - Intronic
965480946 3:169218994-169219016 GATCTTGGATGTGTGTCTGTGGG + Intronic
966819853 3:183915765-183915787 GATTGTGGGTGTGTGTGTTGGGG - Intergenic
966933203 3:184689066-184689088 CCTCTTGGAGTTGTGTGATGCGG - Intergenic
969292266 4:6247622-6247644 GATCCTGGATGTGTCTGTGGGGG - Intergenic
969700296 4:8764240-8764262 GATGTGGCCTGTGTGTGATGGGG + Intergenic
971416520 4:26436856-26436878 GATTTTTGAGTTGTGTGATGAGG - Intergenic
974773417 4:66446487-66446509 GATCTTTGATGGGTTGGATGAGG - Intergenic
974891086 4:67884322-67884344 GATCTTGGCTGGCTGTGTTGAGG - Intergenic
976205314 4:82618579-82618601 GAGTCTGGATGTGGGTGATGAGG + Intergenic
979604422 4:122622783-122622805 GATCGTGGATGAGGGTGAAGGGG + Intergenic
979633897 4:122935426-122935448 GATCTGTGTTGTGTGGGATGGGG + Intronic
980404867 4:132343830-132343852 GATCTTGGATGGGTTTTTTGGGG + Intergenic
983063469 4:163184001-163184023 GATCTTGAGTGTGTCTGAGGAGG - Intergenic
983294418 4:165847959-165847981 AGTCTTGGCTGTGTATGATGTGG + Intergenic
984399695 4:179245657-179245679 GACCTTCGATTTGTGTGATTAGG - Intergenic
984876605 4:184373709-184373731 GATCCTGGGTGTGTCTGCTGAGG - Intergenic
984924633 4:184796002-184796024 GATCCTGGATGTGTCTGTTGAGG + Intronic
985146907 4:186903076-186903098 GAACTGGCATGTGTGAGATGAGG + Intergenic
986711412 5:10490725-10490747 GATCTTGGATGCTTGTCATCTGG - Intergenic
989310388 5:40010303-40010325 GGTCTTGGATGGGTATGAAGAGG - Intergenic
994742543 5:103638895-103638917 GGACTAGGATGTGTGTTATGTGG + Intergenic
998223208 5:140304899-140304921 TATCTTTGCTCTGTGTGATGGGG - Intergenic
998771999 5:145556397-145556419 GATATTGGATGTGAGAGATGAGG - Intronic
998880514 5:146640687-146640709 GATCTTCGCTGTGTGGGAGGGGG + Intronic
1003955441 6:11161174-11161196 GATTTTGGATGAGTGGGATGAGG - Intergenic
1004041612 6:11983813-11983835 TACCATGGATGTGTGAGATGGGG + Intergenic
1006452104 6:34111252-34111274 GCTCTTGAATGTGTGTGGGGTGG - Intronic
1006457152 6:34138461-34138483 GATGTGGGATGTGGGTGATGAGG - Intronic
1007596958 6:43057054-43057076 TTTTTTGCATGTGTGTGATGGGG + Intronic
1009653621 6:66510327-66510349 GATTTTGAATGTGAGTGATAAGG - Intergenic
1011762301 6:90580706-90580728 TTAGTTGGATGTGTGTGATGGGG - Intronic
1014345340 6:120263360-120263382 GAACTTGGATATCTATGATGTGG + Intergenic
1014483733 6:121972822-121972844 GAACATTTATGTGTGTGATGTGG + Intergenic
1014925854 6:127268531-127268553 GATTTTGGATGTGTTTGTTTTGG + Intronic
1017475141 6:154782932-154782954 GATCTTGGATGTGTCTGTGAGGG - Intronic
1017648552 6:156561315-156561337 GTGCTGGGATCTGTGTGATGTGG - Intergenic
1018537164 6:164833499-164833521 GATTGTGTGTGTGTGTGATGTGG + Intergenic
1018787519 6:167119797-167119819 GTGCTTGGATCTGTGTTATGTGG - Intergenic
1018822847 6:167386850-167386872 GATGTTGTATGTGTGTCCTGAGG + Intergenic
1018842263 6:167525824-167525846 GAGCTTGGAGGTGGGAGATGGGG + Intergenic
1020796506 7:12684115-12684137 TATTTTGTATGTGTGTGTTGTGG + Intergenic
1021149004 7:17126400-17126422 GAGCTTGAATGTGTAAGATGAGG - Intergenic
1021445749 7:20731829-20731851 GGGCTTGGATGAGTGTGAAGAGG - Intronic
1024964407 7:55009484-55009506 GATCTGAGATGTGTGTCATTAGG + Intergenic
1025211662 7:57022644-57022666 GCTCTTGGCTGTGTGTGGCGTGG + Intergenic
1026319910 7:69259281-69259303 GATCTGTCCTGTGTGTGATGCGG + Intergenic
1028472957 7:91224380-91224402 GAGCTTGGATGTGTGAACTGGGG + Intergenic
1029790785 7:102840947-102840969 TATCTATGATGTATGTGATGAGG + Intronic
1030674300 7:112368438-112368460 GATCTTGGATGTGTCTGTGAGGG + Intergenic
1030812457 7:113990315-113990337 TATCTTGGATCTGAGTCATGTGG - Intronic
1031372049 7:120980111-120980133 GAAAATTGATGTGTGTGATGTGG - Intergenic
1031872818 7:127105846-127105868 CATCTTGTATGTGTACGATGAGG - Intronic
1031913472 7:127541330-127541352 GATGTTGGATGTGACAGATGTGG - Intergenic
1032239820 7:130151859-130151881 GGTCTGTGGTGTGTGTGATGTGG - Intergenic
1032468466 7:132161537-132161559 GATCTAGGAGGTCTGGGATGGGG + Intronic
1033152909 7:138931956-138931978 GTTCCTGGAGGTGTGTGGTGGGG + Intronic
1034169429 7:149051368-149051390 GATCTTGGATGTGTCTGTGAGGG + Intergenic
1034806401 7:154093119-154093141 TATGTAGGATGTGTGTTATGTGG - Intronic
1036086531 8:5618639-5618661 GGTCTTGGGTGTGTGTGTGGGGG + Intergenic
1036651229 8:10645505-10645527 GATATTGGACATCTGTGATGTGG - Intronic
1038035244 8:23681923-23681945 GATTCTGGATCTGTGTGCTGAGG + Intronic
1038478268 8:27884157-27884179 GATATTGGATGTATTTGCTGCGG + Intronic
1038754532 8:30328284-30328306 GATATTGGATGTGAGGGATAAGG - Intergenic
1039712574 8:40071218-40071240 GGTGTTGGATTTGTGTTATGAGG + Intergenic
1039821238 8:41137285-41137307 GAGGTGGGAGGTGTGTGATGGGG - Intergenic
1039893905 8:41702543-41702565 GTTCTTGGGTGTCAGTGATGGGG + Intronic
1040279893 8:46034792-46034814 GAACTTGGAGGTGTGGGAGGGGG + Intergenic
1041724883 8:61008903-61008925 GATCTTCCCTGGGTGTGATGGGG + Intergenic
1041925790 8:63234834-63234856 GATCTGGGCTGTGTGTGCTATGG - Intergenic
1042215233 8:66424614-66424636 GGTCTTGGATGTTTATGATCTGG - Intergenic
1045491428 8:102672007-102672029 GGTCTTGGATGTGGCTGAAGTGG - Intergenic
1046228406 8:111317441-111317463 GTTCTTGGATGTCAGTGATTAGG + Intergenic
1046377226 8:113399685-113399707 TTTCTTTGATGTGTGTGTTGTGG + Intronic
1048278195 8:133083745-133083767 AATGTTGGAATTGTGTGATGTGG + Intronic
1049773583 8:144394769-144394791 GATCATGGATGTGATTGAGGTGG - Exonic
1051403452 9:16708454-16708476 CATGTTGTATGTGTGTGTTGAGG - Intronic
1052480326 9:29016612-29016634 GAATTTGGATGTTTGTGATCAGG - Intergenic
1052753755 9:32519972-32519994 AATCTTGGAAATGTATGATGAGG + Intronic
1053663283 9:40299422-40299444 GAGGTTGGATGTGTGGGAAGGGG + Intronic
1053664500 9:40308062-40308084 GATGTTGGATGGGGGGGATGGGG + Intronic
1053913784 9:42929953-42929975 GAGGTTGGATGTGTGGGAAGGGG + Intergenic
1054375403 9:64445646-64445668 GAAGTTGGATGTGTGGGAAGGGG + Intergenic
1054520114 9:66068222-66068244 GATGTTGGATGGGGGGGATGGGG - Intergenic
1054521332 9:66076863-66076885 GAGGTTGGATGTGTGGGAAGGGG - Intergenic
1054803521 9:69376659-69376681 GCTCTGGGTTGTGTGGGATGTGG + Intronic
1055618605 9:78099599-78099621 GATTTTGGAGGTGGGAGATGGGG - Intergenic
1056675412 9:88672833-88672855 TATATTGTATGTGTGTGGTGTGG + Intergenic
1056852886 9:90098760-90098782 GATGTGTGCTGTGTGTGATGTGG - Intergenic
1057666305 9:97048257-97048279 GATCTAGGATTTGTGTGTTGTGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1059756101 9:117294962-117294984 AAGGTTGGATGTGTGTGAAGAGG - Intronic
1059986103 9:119822308-119822330 GATCTGGGGTGTGTGCTATGTGG - Intergenic
1061485510 9:130918624-130918646 GAACTTGGATGTGTGAGCTACGG + Intronic
1061596289 9:131631535-131631557 GGGCCTGCATGTGTGTGATGAGG + Intronic
1062603704 9:137332949-137332971 GATCCTGGATGTGTCTGTGGGGG + Intronic
1187768378 X:22668177-22668199 CATCTTGAACGTGTGTGTTGAGG + Intergenic
1187793946 X:22980796-22980818 GAGCTGGGAGGTGTGGGATGGGG - Intergenic
1189227536 X:39425802-39425824 GATATTGTATGTGTATGGTGGGG - Intergenic
1196820179 X:119694865-119694887 GAACTTGGATGCGTGCGAGGGGG + Intergenic