ID: 1132251548

View in Genome Browser
Species Human (GRCh38)
Location 15:100339432-100339454
Sequence TTAAACACTTTGGCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132251546_1132251548 8 Left 1132251546 15:100339401-100339423 CCATGTACAGTACAATGATGTGA 0: 1
1: 0
2: 2
3: 7
4: 125
Right 1132251548 15:100339432-100339454 TTAAACACTTTGGCAAAAACAGG 0: 1
1: 0
2: 0
3: 23
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132251548 Original CRISPR TTAAACACTTTGGCAAAAAC AGG Intronic
903121522 1:21219580-21219602 TTAAACACTGTGGAATACACTGG - Intronic
904844755 1:33401778-33401800 TTAAACAGTATGGGAAAACCAGG + Intronic
909077135 1:71062718-71062740 TTAAACCTTATGTCAAAAACAGG + Intergenic
910794352 1:91083053-91083075 TTAAACACTTGATCAAAAAGAGG - Intergenic
911269224 1:95780357-95780379 GTAAACATTTTCTCAAAAACGGG + Intergenic
911291259 1:96059082-96059104 CCAAACACTTTGGCAAAATGTGG + Intergenic
912091650 1:106083580-106083602 TTAAACACTCTGGCTAGTACTGG - Intergenic
912173397 1:107128335-107128357 TTAACAAGTTTGGTAAAAACTGG + Intergenic
912718207 1:111997438-111997460 TACAACACTTTTGCAAAAGCTGG - Intergenic
913182690 1:116337287-116337309 GGAATGACTTTGGCAAAAACAGG + Intergenic
916779255 1:168007277-168007299 AGAAACAATTTGGCAAAAAAAGG - Intronic
916837994 1:168568793-168568815 TAAAACACTTTGGGAAATGCTGG + Intergenic
916995839 1:170299845-170299867 TTGAACACTTGGGTAAAAAAGGG - Intergenic
917200563 1:172510261-172510283 TTAGACACCTAGGCAGAAACAGG - Intergenic
919107652 1:193173373-193173395 TTAAATACTTTAGAAAAAAAAGG - Intronic
921778034 1:219125581-219125603 TTAAACTCTTTGGGAAGATCAGG + Intergenic
922940121 1:229456116-229456138 GTGAACATTTTGGCAAGAACAGG + Intronic
924197467 1:241623347-241623369 TAAAACAGTTTGGCAAGAGCTGG - Intronic
924646567 1:245883233-245883255 TTATACAGTTTGGAAAAAATAGG - Intronic
1064320556 10:14300538-14300560 ATAAGCACTTGGCCAAAAACTGG + Intronic
1064388108 10:14916824-14916846 TTGATCAATTTGGCAAGAACTGG - Intronic
1065959086 10:30719579-30719601 TTAAGCACTTTGGGAAAATCTGG - Intergenic
1067366852 10:45639452-45639474 TCAATCACTTTGGAAAAAACTGG + Intronic
1068555532 10:58454581-58454603 TTGAAAATTTTGGCAACAACAGG + Intergenic
1070351127 10:75593060-75593082 TGAAACACATTGTCAAAAAACGG + Intronic
1071875077 10:89836528-89836550 GTAAACACTTTATCAAACACAGG + Intergenic
1072289021 10:93945414-93945436 TTAAAGACATGGGCATAAACTGG + Intronic
1074138929 10:110653987-110654009 TTAAACATTTTGGCAAAGATAGG + Intronic
1075750020 10:124760729-124760751 AAAAACAATTTGGAAAAAACAGG + Intronic
1075797640 10:125132204-125132226 TCTAAAACTTTTGCAAAAACAGG + Intronic
1078219309 11:9338142-9338164 TTAAAAAGTTTTGCAAAGACGGG - Intergenic
1079683435 11:23326444-23326466 TTAAAAACTTAGGAAACAACAGG + Intergenic
1080132161 11:28809077-28809099 TGAAGCACTTTGGGAGAAACAGG - Intergenic
1080294446 11:30709518-30709540 TTAAACAGTTTTGCAGAGACAGG + Intergenic
1080671711 11:34385594-34385616 TCAAACACTTTGGAAAAAGATGG - Intergenic
1082846751 11:57732370-57732392 TTATACAGTTTGGGAAAAAGAGG - Intronic
1083108000 11:60377125-60377147 TTTAACAATTTGGTCAAAACAGG + Intronic
1083188089 11:61029483-61029505 TGAAACTCTATGGCAAAAAAAGG + Intergenic
1083461415 11:62814919-62814941 TTAAACAGTTTGGGGACAACTGG + Intronic
1084909541 11:72376984-72377006 TTAAACACTTGGGTAATTACCGG + Intronic
1085330348 11:75644174-75644196 TTATACACTATTGCAAAATCAGG - Intronic
1086245792 11:84750991-84751013 TTAAATACATTGCCAATAACAGG - Intronic
1098317754 12:69209860-69209882 TTAAACAATTTCTCTAAAACTGG - Intergenic
1100056039 12:90510837-90510859 TTCAACACTTTGTCTAGAACTGG - Intergenic
1100387507 12:94117570-94117592 TTAAGTACTTTTGCAAAATCAGG + Intergenic
1101831890 12:108264158-108264180 TTAAACACTTTGCACAGAACTGG - Intergenic
1102073467 12:110041137-110041159 TCAAACACTTGGGAAATAACTGG + Intronic
1102948112 12:117007984-117008006 TTAAACATTTTAGAAAATACTGG + Intronic
1103109618 12:118264149-118264171 TAAAACACTTTGGAAAACATTGG + Intronic
1105237341 13:18569607-18569629 TTACACACATTGAAAAAAACAGG - Intergenic
1107737027 13:43409984-43410006 TTAAGCAATTTGGCTAACACAGG + Intronic
1109389163 13:61670872-61670894 TTAAACCCTTTGGCCAGAAAAGG + Intergenic
1110491100 13:76109058-76109080 CTAAACTCTATGACAAAAACAGG - Intergenic
1110792052 13:79597277-79597299 TTTAATACTTTGCCAAAAGCAGG + Intergenic
1111187960 13:84765776-84765798 TTAAACACTCTTACAAAAAAAGG - Intergenic
1111200142 13:84926231-84926253 TTAAACACTTTCTCAAATCCTGG - Intergenic
1112147930 13:96722397-96722419 TTAAAGACTTTATAAAAAACAGG - Intronic
1112689031 13:101868605-101868627 TCAAATACTAAGGCAAAAACTGG + Intronic
1115016584 14:28622931-28622953 TGAAACAGTTTGGAAAAAAGAGG + Intergenic
1115486068 14:33912325-33912347 TTAAACATTTTGGTGAAGACAGG - Intergenic
1116334211 14:43636534-43636556 TTAAACTCTTAGGCATTAACTGG + Intergenic
1117144551 14:52823909-52823931 TTAAACACTTTACCGAAAAAAGG - Intergenic
1117552183 14:56847489-56847511 TGAAACACTTTGGCCAGATCTGG - Intergenic
1117820439 14:59644000-59644022 TTAAAGACTTTGTGAAAAATAGG + Intronic
1117933454 14:60873080-60873102 TGAAACATTTTGGCAACAATTGG - Intronic
1119057298 14:71435834-71435856 TTAAAAAGTTAGGCAACAACAGG - Intronic
1119604253 14:76001149-76001171 AAGAACACTTTGGCAACAACTGG + Intronic
1120602343 14:86527083-86527105 ATAAATACTCTGGCCAAAACAGG - Intergenic
1120743841 14:88136172-88136194 CAAAACACTATGGCAAAAACAGG - Intergenic
1121071291 14:91024581-91024603 TTATACATTTTTGCAGAAACAGG - Intronic
1122106126 14:99456689-99456711 TTAAACAAATTGACAAAAAATGG + Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1127078878 15:55355482-55355504 TTAAATACTTCGGTAAACACTGG + Exonic
1127237041 15:57065095-57065117 TTAAATCCTTTGGAAAGAACTGG + Intronic
1128308099 15:66613321-66613343 CTAAAGACTGTGGCTAAAACAGG + Intronic
1132251548 15:100339432-100339454 TTAAACACTTTGGCAAAAACAGG + Intronic
1133816412 16:9200800-9200822 TTCTACACTTTGGAAAATACTGG + Intergenic
1141674595 16:85510927-85510949 TTGACCACTCTGTCAAAAACTGG + Intergenic
1141901593 16:86994670-86994692 TTAAACGCATTGTCAAAACCAGG + Intergenic
1144216693 17:13061865-13061887 TTCAACAAATTGGGAAAAACTGG - Intergenic
1144234773 17:13248573-13248595 TTACACACTATGGCCAAAAGGGG + Intergenic
1146213995 17:30964085-30964107 TGAAAGAATTTAGCAAAAACAGG + Intergenic
1147297786 17:39498163-39498185 TTAAAAATTTTGGTAGAAACAGG + Intronic
1147355134 17:39889622-39889644 TGAAACAATTTGGCAGAAAAAGG - Intergenic
1151203428 17:72486829-72486851 TAAAAGACTCTGGCAAATACAGG + Intergenic
1155358663 18:24979110-24979132 CTAAACAGTGTGGCAAAAAAAGG + Intergenic
1156409430 18:36813504-36813526 TGAAACATTTTTACAAAAACAGG - Intronic
1156578721 18:38350362-38350384 TTAATCACTTTGGTAAATAAAGG + Intergenic
1156743101 18:40356866-40356888 CTAAACACTTTAGTAACAACAGG - Intergenic
1156746949 18:40403718-40403740 TGAGACATTTTGGCAAAAACGGG - Intergenic
1157536876 18:48466066-48466088 TTTAAGACTTTTGGAAAAACTGG + Intergenic
1158792414 18:60797825-60797847 TTAAAAACTTAGGAAACAACAGG - Intergenic
1159287542 18:66373639-66373661 TTAAACACAATGGGAATAACTGG + Intergenic
1159791864 18:72791739-72791761 TTAAAGACTTTTTAAAAAACAGG - Intronic
1160595843 18:79973597-79973619 TTAAAGCCTTTGGAAAATACAGG - Exonic
1161554192 19:4931196-4931218 GTAAACACTTGTGCAAAGACTGG - Intronic
1163356675 19:16816998-16817020 TTAAAAATAATGGCAAAAACTGG + Exonic
1167830839 19:52021075-52021097 TTAAACAATTTGGCACATAGGGG + Intronic
1167979004 19:53256993-53257015 ATAAATACTTTGACAAAAATAGG + Intergenic
926827715 2:16924329-16924351 TTAATCAGTTTGGTAACAACTGG + Intergenic
927850764 2:26497921-26497943 TAAAAATCTTTGGCAAAAAAGGG - Intronic
928907443 2:36382122-36382144 TTAAAGCCTTTGGCAGAATCAGG + Intronic
930833566 2:55771283-55771305 ATAAACACTTTGACAGATACTGG - Intergenic
930892452 2:56406674-56406696 TTTAACACTTTGTCCAAAATAGG + Intergenic
930979511 2:57506123-57506145 TAAAACACTTAGACAAAAATAGG - Intergenic
933873831 2:86598285-86598307 GTAAAAAGTTTGGCAAAAGCTGG + Intronic
933937058 2:87215040-87215062 TTACACAATTGGGAAAAAACAGG - Intergenic
936356083 2:111750784-111750806 TTACACAATTGGGAAAAAACAGG + Intergenic
938512436 2:131964896-131964918 TTACACACATTGAAAAAAACAGG + Intergenic
938745065 2:134269937-134269959 TTAAACACTTTTTAAAAAACTGG + Intronic
939783504 2:146478632-146478654 TTCAACATTTTGGCTGAAACTGG + Intergenic
940628223 2:156203686-156203708 TTATTCATTTTGGCAAAAAAGGG - Intergenic
941189538 2:162362224-162362246 TCAAAAAGTTTGGAAAAAACTGG - Intronic
942312961 2:174672572-174672594 TTAAATACTTAGTCAAAAACAGG + Intronic
942512178 2:176714526-176714548 TTAACCACCTTGGCCAAAGCTGG - Intergenic
943486974 2:188497113-188497135 TTAATTACTTTTTCAAAAACGGG - Intronic
944388718 2:199194515-199194537 TTAAAGACTTAAGCAAACACTGG + Intergenic
945688270 2:212999157-212999179 TCAATCACACTGGCAAAAACTGG - Intergenic
945801602 2:214438776-214438798 TTATACACTTTTGTAAAAAGAGG - Intronic
946705622 2:222455894-222455916 TTAAAAACTTTTGTAGAAACAGG - Intronic
947165550 2:227257992-227258014 TTAAACACGTTGTCATAACCCGG - Intronic
1170996108 20:21360536-21360558 TCAAAGACTTTGGCAAACACTGG - Intronic
1171176567 20:23054550-23054572 TAAAACTCTTTCCCAAAAACTGG + Intergenic
1173423054 20:42919507-42919529 TTAACAACTTTTCCAAAAACAGG + Intronic
1174978143 20:55358397-55358419 TGAAACACTTTGGCACACTCAGG - Intergenic
1175538427 20:59732209-59732231 GAAAACACTTTGGGAAACACCGG + Intronic
1176284180 21:5010441-5010463 TTAAAAACTTTGGCAGAATTTGG - Intergenic
1176781328 21:13197890-13197912 TTACACACATTGAAAAAAACAGG - Intergenic
1177409518 21:20711462-20711484 GTAAACACTTCAGCAAAAAGTGG - Intergenic
1177580232 21:23012812-23012834 TTAAACAAAATGTCAAAAACCGG - Intergenic
1179873001 21:44253034-44253056 TTAAAAACTTTGGCAGAATTTGG + Intronic
1180235358 21:46456119-46456141 TTTAACACCTTGGCAAAGAGTGG - Intergenic
1185161720 22:49233975-49233997 TCAGACACTTTGGCCAAAGCCGG - Intergenic
949184763 3:1177036-1177058 TTAAACATTATGGCAAGAAAAGG - Intronic
949831369 3:8218304-8218326 TTAAACTCTTCTGCAAAATCTGG + Intergenic
951378149 3:21949232-21949254 TTAAACACTATTGAAAAATCAGG - Intronic
952360358 3:32625009-32625031 TAAAACTCTTAGACAAAAACAGG - Intergenic
956174906 3:66463648-66463670 TTAACCTCTTTGGCAAACACGGG - Intronic
956331458 3:68114639-68114661 TGAAACACTTTGACAAATATTGG + Intronic
956755193 3:72378870-72378892 TTAAATACTGTGGCCAGAACAGG - Intronic
958423656 3:93956699-93956721 TTAAAAAACTTGGCAAATACTGG - Intronic
958872769 3:99580511-99580533 TTAAACAGTTGGACAAAGACAGG - Intergenic
959577236 3:107947625-107947647 TTCATCACTTTGGCCAAAACTGG + Intergenic
960067587 3:113391259-113391281 ATAAACAGTTTTGGAAAAACTGG + Intronic
961838259 3:129683129-129683151 TTAAAAACTTTGGCAAGGGCCGG - Intronic
961841572 3:129718035-129718057 TGAAACAATTTGGGAAAAAATGG + Intronic
964678466 3:159310515-159310537 TTAAATACTTTGGAAAAGCCAGG - Intronic
965552513 3:169982691-169982713 TAAAAGCCTTTGGGAAAAACAGG - Exonic
965693947 3:171387399-171387421 TTACACACACTGGCAAACACTGG - Intronic
966081707 3:176012466-176012488 TTTAACTCATTGGCAAAACCAGG + Intergenic
966699034 3:182824497-182824519 TTAAAAACTATGTCAAATACTGG - Intronic
967762017 3:193236834-193236856 ATAATCAGTTTGGAAAAAACTGG + Intergenic
970413956 4:15838144-15838166 GTAAAATCTTTGACAAAAACAGG + Exonic
970498598 4:16653565-16653587 TTAAACACTTTGGAGAAGAGTGG - Intronic
970921257 4:21397942-21397964 TTAAGCAATTTTCCAAAAACTGG + Intronic
971262835 4:25072665-25072687 TGAAACACTTTTTTAAAAACAGG + Intergenic
971986377 4:33830101-33830123 TTAAACATTTTGTGAAGAACAGG - Intergenic
972312925 4:37898293-37898315 TAAAACACCTTGGAAAAAAGAGG + Intronic
973178574 4:47240325-47240347 ATAATAACTTTGGCAAAAATAGG - Intronic
973285695 4:48413701-48413723 ATAAACACATTGCCAAACACTGG - Intronic
974495867 4:62625810-62625832 TTAAACACTTTGGTAATATGAGG + Intergenic
975302223 4:72803153-72803175 TGAAACACTTTTGCAAAGATGGG + Intergenic
975486411 4:74938064-74938086 TTAATAACTTAGGAAAAAACAGG + Intronic
976274783 4:83265258-83265280 TTAAACACTGTATCGAAAACTGG + Intronic
978073535 4:104500267-104500289 GTAAATACTTTGACAAAATCTGG - Intergenic
979122729 4:116924298-116924320 TTAAACACCTTGACAAAATATGG - Intergenic
979406368 4:120315517-120315539 TTAAAAAATTTGGAAAAAAAAGG - Intergenic
980120169 4:128719711-128719733 TTAAAGACTTTGGAAAAAAGTGG + Intergenic
980224847 4:129969319-129969341 TTAAACACTTTTCAAAAAAAGGG + Intergenic
981009143 4:139906597-139906619 TAAATCACTTTGCCTAAAACAGG + Intronic
981559001 4:146026581-146026603 TTAAACAAATAGGCAAAAGCAGG + Intergenic
983183193 4:164672326-164672348 TAACACACTTTGGGAAACACTGG + Intergenic
983898496 4:173106684-173106706 TTAAAGGCTTAGGCAGAAACAGG + Intergenic
983902183 4:173147282-173147304 TTAATGAATTTGGCAAAAAGAGG - Intergenic
984239618 4:177201915-177201937 TTAAACATTTTGTAAAAAACTGG - Intergenic
984282075 4:177682790-177682812 TTAAACACTGAGGCAGAAATAGG - Intergenic
985344672 4:188990776-188990798 TAAAAGACTTTGACAGAAACAGG + Intergenic
986698804 5:10383670-10383692 TTAAACCTTTTTGAAAAAACAGG + Intronic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
992519102 5:77531046-77531068 TAAAACTCTTAGGAAAAAACAGG + Intronic
992702032 5:79350550-79350572 TTAAACACCTTTGCACAAAAGGG + Intergenic
992982313 5:82188595-82188617 TTAACCTCTTTCTCAAAAACTGG - Intronic
993691266 5:91003662-91003684 TTAAACACTCAGACAAAAATTGG + Intronic
994104577 5:95932421-95932443 AGAGACACTTTGGCAAAAAAGGG + Intronic
994365710 5:98914405-98914427 ATAAACATTTTGGAAAGAACAGG + Intronic
994610364 5:102030163-102030185 ATAAACACTATGGTAAAAAGTGG - Intergenic
994712117 5:103278694-103278716 TGAAACTCTGTGGCAAAAATAGG + Intergenic
997524925 5:134546373-134546395 TCAAACACTGTGCCAAAAGCAGG + Intronic
997630513 5:135365039-135365061 TCCAAAAGTTTGGCAAAAACTGG + Intronic
998609950 5:143677444-143677466 TGAAACACTTTGGTGAGAACAGG + Intergenic
1000674012 5:164098349-164098371 TTTATCACTTTGGAAAAAGCTGG - Intergenic
1002605424 5:180380284-180380306 TTCAAAATTTTGGCAAGAACTGG - Intergenic
1004387873 6:15188091-15188113 TTTAAGACTTTGGTGAAAACAGG - Intergenic
1004978641 6:20997207-20997229 GTAAACACTTTGGTAACACCAGG + Intronic
1005172166 6:23000396-23000418 TTAAAAACTTATACAAAAACAGG + Intergenic
1005941993 6:30567489-30567511 TTAAACATTTTTGCAGACACAGG - Intergenic
1007000126 6:38303696-38303718 TCAAACTCTTTGGGAAAAAAAGG + Intronic
1007008098 6:38386812-38386834 TTATACACTTTTGTAAAGACAGG + Intronic
1008435032 6:51466284-51466306 TTAAACACTTTTCCTAACACTGG + Intergenic
1008485833 6:52034530-52034552 TTTGACACTTTGGCCAATACTGG - Intronic
1009523075 6:64708939-64708961 TTAAACACGATGTCAAAAACTGG - Intronic
1010942653 6:81936985-81937007 TTAAACATTTGGGGTAAAACGGG - Intergenic
1011580789 6:88861793-88861815 TTAAAAACTTTGGGGAAAACTGG - Intronic
1013850002 6:114502886-114502908 TTAAAAAGTTAGGAAAAAACAGG + Intergenic
1016003664 6:139067651-139067673 TGAAACACACTTGCAAAAACAGG - Intergenic
1017001751 6:150002136-150002158 TTTAACACTTTGGCAAAGCCCGG + Intergenic
1017083846 6:150695102-150695124 TTACAAACTTTTGAAAAAACAGG - Intronic
1017275360 6:152560526-152560548 TTAAACAGTTTGGGAAAGATTGG - Intronic
1019168992 6:170117997-170118019 TTTTCCAGTTTGGCAAAAACTGG - Intergenic
1021244311 7:18243384-18243406 TTGAACACTTTGGCAAAACATGG - Intronic
1022929063 7:35091601-35091623 TTTGTCACTTTGGAAAAAACTGG + Intergenic
1023358382 7:39390705-39390727 TTATACACTCTGGGAAAAGCTGG - Intronic
1027763645 7:82310829-82310851 TAAAACACTTTATCAAAAATAGG - Intronic
1028317331 7:89419725-89419747 TTAAAGATTTGGGCTAAAACTGG + Intergenic
1028381426 7:90204285-90204307 TTAAAAAGTTAGGCAACAACAGG + Intronic
1029015045 7:97307110-97307132 TTAAACAAATTGGCATAAGCAGG + Intergenic
1029040624 7:97569554-97569576 TTCTCCACTTTGGTAAAAACTGG - Intergenic
1029257902 7:99281695-99281717 TAAGACACTGTGGCAACAACAGG + Intergenic
1029491226 7:100871340-100871362 TTAAACACTATGAGAAAAACAGG - Intronic
1031018954 7:116605937-116605959 TAAAATACTTTGGCAAAACTGGG + Intergenic
1032639113 7:133745628-133745650 TTAAACATTTTTGAAAAGACTGG + Intronic
1032822125 7:135533726-135533748 ACAAAAACTTTGGGAAAAACAGG + Intergenic
1032880088 7:136079862-136079884 CTTAACACTTTGGCATGAACTGG + Intergenic
1033531636 7:142269879-142269901 TTCAACACTTTGGAAGAAAGAGG + Intergenic
1033838067 7:145339651-145339673 TTGAACACTGTTGCAATAACTGG + Intergenic
1034966810 7:155396660-155396682 TTAAACACATTGGCACCCACAGG + Intergenic
1036923380 8:12880031-12880053 TCCAGCACTTTGGCAAAATCAGG + Intergenic
1037022443 8:13990023-13990045 TTCAACACTTTGGAGAAAATTGG + Intergenic
1037419051 8:18682733-18682755 TGAAAGACTTTGGCATTAACAGG - Intronic
1041622865 8:59993308-59993330 TTAAGCATATAGGCAAAAACTGG + Intergenic
1041860458 8:62507117-62507139 TCAAACACTTTGGAAAACAAAGG - Intronic
1042714192 8:71754338-71754360 TTAAACTCTTTAGTAAGAACTGG - Intergenic
1043526295 8:81100200-81100222 CTAATCATTTTGGCAAAGACAGG + Intronic
1044026575 8:87179852-87179874 TTAATCAGTATGTCAAAAACTGG + Intronic
1045577607 8:103442138-103442160 TTAAACATATTCTCAAAAACAGG - Intronic
1045828134 8:106425692-106425714 TTAAAAACTGTGCCAAAGACTGG + Intronic
1046143685 8:110128780-110128802 TTAATCTCTTTGGCAACTACTGG - Intergenic
1046365139 8:113219035-113219057 TTAAAAACTCTTGGAAAAACAGG + Intronic
1046408555 8:113808087-113808109 TTAAATACCTTGGAAGAAACTGG - Intergenic
1046928447 8:119818518-119818540 TTAAACACTAGGGCACAATCAGG + Intronic
1047030293 8:120870448-120870470 TTCAACACTTTCGTAAAAACTGG - Intergenic
1047867822 8:129047732-129047754 ATAAATACATTGGAAAAAACTGG + Intergenic
1048681881 8:136851844-136851866 TGAAACACTTTGGAAATAAAAGG - Intergenic
1049999236 9:1058583-1058605 TTAAAAATTTTGGTAGAAACAGG + Intergenic
1050911745 9:11080307-11080329 ATAAACCCATTGGCAAAAACAGG - Intergenic
1051051424 9:12936847-12936869 TTAAGTACTTTGGGAAAAACTGG - Intergenic
1051083668 9:13322543-13322565 TTAAACACTTTAAAAAAAAAAGG - Intergenic
1052560250 9:30076180-30076202 TCAAACAAGTTGGAAAAAACTGG + Intergenic
1052617935 9:30866728-30866750 TTCAACAATTTGGCTAAAAGTGG - Intergenic
1054839715 9:69723531-69723553 TCAAAGACTTAAGCAAAAACTGG + Exonic
1056229727 9:84530796-84530818 TTAAAAAGTTAGGCAACAACAGG - Intergenic
1056618515 9:88189825-88189847 TTAAACACTTTGGAAGCAATTGG + Intergenic
1057184793 9:93051153-93051175 CTAAACAGTTTAGCAAATACGGG + Intergenic
1057588285 9:96348924-96348946 TTAAAGACTTTTGCAAAAAATGG - Intronic
1058275370 9:103035322-103035344 TTAATTACTCTGGGAAAAACAGG - Intergenic
1060236304 9:121865449-121865471 TTAAGCAGTTTGCCAAAACCAGG - Intronic
1061347043 9:130034861-130034883 TTAGCCACTTGGCCAAAAACTGG - Intronic
1186253600 X:7696002-7696024 TGAAACACATGGACAAAAACGGG - Intergenic
1187321353 X:18240574-18240596 TTAAAAAATTTATCAAAAACTGG + Exonic
1187975924 X:24705098-24705120 TAAAACTTTTTGTCAAAAACTGG - Intronic
1188152031 X:26688618-26688640 TTATTCACTATAGCAAAAACTGG + Intergenic
1191225596 X:58039789-58039811 ATAAATACTTTGCCAAAAAAAGG + Intergenic
1191233547 X:58116329-58116351 ATAGACACCTTGGCAACAACAGG + Intergenic
1196061648 X:111414141-111414163 TAAAAAACTTTTGCAAAAACTGG + Intergenic
1196097226 X:111813548-111813570 TGTAAGACTTTGTCAAAAACTGG - Intronic
1196531287 X:116789772-116789794 TAAATCACTTTGGCAAATAAAGG - Intergenic
1196706112 X:118718681-118718703 TTAAACTCATTCACAAAAACCGG + Intergenic
1199431727 X:147768852-147768874 TAAAACACTTTTTCAAAAACAGG - Intergenic
1199499310 X:148492604-148492626 GCAGACACTTTGGCCAAAACTGG + Intergenic
1200666283 Y:6029242-6029264 TTAAAAATTTTGGTAAATACTGG - Intergenic
1201319268 Y:12679625-12679647 TAATACACTTTGTCAATAACAGG - Intergenic