ID: 1132251770

View in Genome Browser
Species Human (GRCh38)
Location 15:100340546-100340568
Sequence CTTCTCTCTGTACCTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132251770_1132251774 -8 Left 1132251770 15:100340546-100340568 CCTGTTCCAGGTACAGAGAGAAG 0: 1
1: 0
2: 3
3: 26
4: 228
Right 1132251774 15:100340561-100340583 GAGAGAAGACTCAAAAGGAAGGG 0: 1
1: 0
2: 5
3: 65
4: 642
1132251770_1132251773 -9 Left 1132251770 15:100340546-100340568 CCTGTTCCAGGTACAGAGAGAAG 0: 1
1: 0
2: 3
3: 26
4: 228
Right 1132251773 15:100340560-100340582 AGAGAGAAGACTCAAAAGGAAGG 0: 1
1: 0
2: 4
3: 85
4: 655
1132251770_1132251775 -5 Left 1132251770 15:100340546-100340568 CCTGTTCCAGGTACAGAGAGAAG 0: 1
1: 0
2: 3
3: 26
4: 228
Right 1132251775 15:100340564-100340586 AGAAGACTCAAAAGGAAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132251770 Original CRISPR CTTCTCTCTGTACCTGGAAC AGG (reversed) Intronic
900649175 1:3722670-3722692 CGCCTCTCTGCACCTGGCACAGG + Intronic
900649183 1:3722699-3722721 CACCTCTCTGCACCTGGCACAGG + Intronic
900649244 1:3722947-3722969 CACCTCTCTGTGCCTGGCACAGG + Intronic
900649270 1:3723059-3723081 CACCTCTCTGCACCTGGCACTGG + Intronic
900649290 1:3723140-3723162 CACCTCTCTGTGCCTGGCACGGG + Intronic
902193298 1:14778971-14778993 TTTCTCTCTGCACCTGGCTCTGG + Intronic
904503841 1:30934747-30934769 CATTCCTCTGTCCCTGGAACTGG + Intronic
906085596 1:43130975-43130997 CTTCTTTCTGTTCCTTGCACAGG + Intergenic
907251103 1:53140424-53140446 GTTCTCTCTGTGCCTGACACAGG + Intronic
908006232 1:59732114-59732136 CCTCACTCTGTGCCAGGAACTGG - Intronic
910186709 1:84549412-84549434 TTTACCTCTGTACCTGGGACAGG + Intergenic
910371632 1:86523121-86523143 TATCTCTTTGTATCTGGAACTGG + Intergenic
912244600 1:107947858-107947880 CTTGGCTCAGTACCTGGCACAGG - Intronic
912519413 1:110234943-110234965 CTTCACTCTGTCTCTGAAACAGG - Intronic
913193947 1:116438629-116438651 CTTCTCTATGTTCCTGAGACGGG + Intergenic
915473197 1:156137892-156137914 CTCCTCCCTATACCTTGAACAGG + Intronic
915589367 1:156861782-156861804 CTTGTCTCTCTACCTGGGGCGGG + Intronic
916461444 1:165029030-165029052 TTTGTCTCTGTTCCTGGCACAGG + Intergenic
917143099 1:171857481-171857503 ATTCTCTCTCTACTTGCAACTGG + Intronic
919658865 1:200223678-200223700 CTTCTTTCTGCTCCTTGAACAGG - Intergenic
920211508 1:204332025-204332047 CTTGTCTCTCTTCCTGGAGCAGG - Intronic
921759045 1:218890834-218890856 TTTCTTTTTGTACCTGTAACAGG - Intergenic
921964379 1:221072553-221072575 CTTCTTTCTGGACCTAGAAAAGG - Intergenic
923469807 1:234280426-234280448 ATTCACTCTGTAGCTGAAACCGG + Intronic
924101074 1:240603263-240603285 CTTCTCTTTGTATTTGAAACTGG - Intronic
924226876 1:241929119-241929141 CTTCTCACTGTACCTGCAAATGG - Intergenic
1064815734 10:19259714-19259736 CTTTCCCCTGTTCCTGGAACAGG + Intronic
1064955795 10:20908053-20908075 CTTTTCTCGGTACCTGGTATAGG - Intronic
1067305898 10:45063747-45063769 CTACTCTCTGTACAAGGAAGTGG + Intergenic
1067509481 10:46883300-46883322 CTACTCTCTCTACCTGGCTCTGG + Intergenic
1067652773 10:48168555-48168577 CTACTCTCTCTACCTGGCTCTGG - Intronic
1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG + Intronic
1068658998 10:59604027-59604049 CTTCTTTCAGTTCCTTGAACAGG - Intergenic
1069920419 10:71812504-71812526 CTTCTGTCGGAACCTGGAGCTGG + Exonic
1070357056 10:75650570-75650592 CTTGGCTCTGACCCTGGAACAGG + Intronic
1070658836 10:78290372-78290394 CTTCCCTCTGCACCTGGACGAGG + Intergenic
1072005651 10:91244307-91244329 CTGCTCCCTTTACCTGGAATAGG - Intronic
1072172142 10:92874834-92874856 CTTCTCTCTGTACTTGGTGGAGG + Intronic
1073075127 10:100819820-100819842 CTTTTCTCTGTACTTGTAAGGGG + Intronic
1073919582 10:108443496-108443518 CTTCTCTCACTCCCTGGAAAAGG + Intergenic
1074266845 10:111912987-111913009 CTTTTCTCTTTTCCTGGTACTGG + Intergenic
1074883536 10:117677110-117677132 CTTCTCTCTCCAGTTGGAACAGG + Intergenic
1075177234 10:120176793-120176815 GTTCTCTGAGTACCTGGCACTGG + Intergenic
1075647833 10:124108090-124108112 CTGCTCTCCGTCCCTGGATCAGG - Intergenic
1076618295 10:131771084-131771106 CTTCTCCCTGGAGCTGGCACTGG + Intergenic
1076926387 10:133490349-133490371 CTTCTCTGTGGGCCTGGAAGTGG + Intergenic
1077124050 11:924773-924795 CTGGACCCTGTACCTGGAACTGG - Intergenic
1077179295 11:1205000-1205022 CATCTCTCTGCACCTGGGCCAGG - Intergenic
1077221882 11:1421588-1421610 CTTCCCTCTGCACCTGGCACTGG + Intronic
1077741352 11:4849057-4849079 CTTCTCTCTGCACTGGGAAATGG - Exonic
1078858782 11:15228386-15228408 GTTCTCTCTGCACCTGGAGTCGG + Intronic
1081066921 11:38554039-38554061 CTTCTTTCTGTAAATGAAACTGG + Intergenic
1081386251 11:42477012-42477034 CTTCTCTCTGTAAATGGTCCTGG + Intergenic
1083191483 11:61055564-61055586 CTTCTCTCTGACCTTGGAGCTGG - Intergenic
1083293636 11:61703510-61703532 CTTCTCTCTGTTCTTGCAACAGG - Intronic
1084557568 11:69883969-69883991 TTTGTCTCTGCACCTGGAATGGG - Intergenic
1085850794 11:80117308-80117330 CCTAACTCTGTACCTGGTACTGG + Intergenic
1085855235 11:80168780-80168802 CTTCTCTCAGTACCTGCCTCTGG - Intergenic
1086062265 11:82712052-82712074 CTTCTCTCACTATCTGGAAGGGG - Intergenic
1087559597 11:99770063-99770085 TCTCTTTCTGTTCCTGGAACAGG + Intronic
1090376624 11:126294063-126294085 CTTCTGTCTTCCCCTGGAACTGG + Intronic
1091267273 11:134281422-134281444 CTTCTCTGGGAACCTGGACCTGG + Exonic
1091275036 11:134344432-134344454 CTTCTCTGGGAACCTGGACCTGG + Exonic
1091434200 12:460484-460506 CTGGACTCTGTATCTGGAACTGG + Exonic
1091683135 12:2541048-2541070 CTTCCCTCTGTACCTGTCAGTGG + Intronic
1092501344 12:9050887-9050909 CCTCTCTCTGCTCCTGGCACTGG + Intergenic
1093528200 12:20129727-20129749 GTATTCTCTGAACCTGGAACAGG + Intergenic
1093543113 12:20311270-20311292 CTCCTCTCTGGAAATGGAACTGG - Intergenic
1093748545 12:22771905-22771927 CTTCTCTCTGTTCCACGAAAAGG + Intergenic
1094337024 12:29371110-29371132 CTTTTATCTGTACCAGGCACTGG + Intronic
1094730720 12:33171508-33171530 CTTCACTAAGTACCTGGAAGTGG + Intergenic
1095642164 12:44497775-44497797 ATTCTCCCTGTACCTAGGACAGG - Intergenic
1096553936 12:52391664-52391686 CGTCTCTCTGGACCTGGGCCTGG - Intergenic
1096589014 12:52644934-52644956 CCTGTCTCTGTACCTCTAACTGG - Exonic
1100605954 12:96152320-96152342 CTTCTCACTGCAACTGGAATTGG + Intergenic
1101090738 12:101282352-101282374 CTTCTCCCTCAGCCTGGAACAGG - Intronic
1102778747 12:115544564-115544586 CTCCTCTCGGCACCTGGAGCTGG - Intergenic
1102949235 12:117018359-117018381 CTCCTCTTTGTCCCTGGAATCGG + Intronic
1105939146 13:25131489-25131511 CTGATCTCTGCTCCTGGAACAGG - Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106463134 13:29990142-29990164 CTTATCTTTTTACCTGTAACAGG + Intergenic
1106488698 13:30195711-30195733 CCTCTCTTTGTTCCTGGAAAAGG - Intergenic
1107722236 13:43260926-43260948 TTTCTCTTTGTAGTTGGAACTGG - Intronic
1109192520 13:59342312-59342334 CTTCTCTGTGCACTTGGTACAGG - Intergenic
1110146997 13:72203671-72203693 CTTTTCTCTGTAAATGGAATTGG - Intergenic
1110168069 13:72467945-72467967 CTTCTCTCTTTTCCTGGCAAAGG - Intergenic
1113064420 13:106358988-106359010 CTTCTCTCTCTCCCTGTACCTGG + Intergenic
1115616836 14:35103281-35103303 CTTCCTTCTGTTCCTAGAACAGG + Intronic
1116748685 14:48853293-48853315 ATTATCTAAGTACCTGGAACTGG + Intergenic
1118734504 14:68691777-68691799 CTGGTCTCTGTGCCTGGCACCGG + Intronic
1119507643 14:75186733-75186755 CATCTCTCTGCACCAGGACCTGG - Intergenic
1119669837 14:76510036-76510058 CTTTCCTCTGTACCTGACACTGG - Intergenic
1127596645 15:60489610-60489632 CTTCACTCAGTTCATGGAACTGG + Intronic
1127624315 15:60765159-60765181 CTTCTCTCTTTCCCTGATACAGG + Intronic
1130073052 15:80665301-80665323 CTTCTCTCAGTCCCTTAAACAGG - Intergenic
1130704172 15:86216883-86216905 CATCTCACTGTTCCTTGAACAGG + Intronic
1130809207 15:87358884-87358906 CTTCTCACTGTCACTGAAACTGG + Intergenic
1131030004 15:89178574-89178596 CTTCTCTCTGAGCCTTCAACCGG - Intronic
1131473915 15:92719943-92719965 CTGTTCTCTGTTCCTGGAACAGG - Intronic
1131998215 15:98153876-98153898 CTTCTGCCTGTGCCTGGAACTGG - Intergenic
1132241110 15:100257619-100257641 GTTTTCTCTGTACCTGGATGAGG + Intronic
1132251770 15:100340546-100340568 CTTCTCTCTGTACCTGGAACAGG - Intronic
1133866923 16:9652608-9652630 CTCTTCTCTGTGCCTGGAATTGG + Intergenic
1134464012 16:14456999-14457021 GTGCTCTCCGTACCTGGCACAGG + Intronic
1135164055 16:20123363-20123385 TTTCTCTGTGTGCCTGGGACAGG + Intergenic
1135955714 16:26954860-26954882 CTTCTGTCTGTCCCTTGAAGGGG + Intergenic
1137614734 16:49839424-49839446 CTGCTCCCTGTGCCTGGCACTGG - Intronic
1138921431 16:61534338-61534360 TATCTGTCAGTACCTGGAACAGG - Intergenic
1138928368 16:61619845-61619867 CTTCTCTTTGTTCCTGGAACAGG - Intergenic
1139217686 16:65144809-65144831 CTTCTACCTGTCCTTGGAACAGG + Intergenic
1139715291 16:68808558-68808580 CTTCTTTCTCTACCTGAACCAGG - Exonic
1141264089 16:82480156-82480178 CTTCACTCTGTGCCTAGCACGGG + Intergenic
1141674275 16:85509417-85509439 CTCGTATCTGTACCTGGAGCTGG - Intergenic
1143469734 17:7165115-7165137 CTTCCCTCTCTTCCTGGAAGAGG - Intergenic
1146486613 17:33248256-33248278 CTTCTCACTGTTCCTTGAACAGG - Intronic
1146511230 17:33450511-33450533 CTTTTCTCTGTTCCTGAAAGAGG + Intronic
1147584507 17:41646175-41646197 CTTCTCTCTGTCCCTGGAAATGG + Intergenic
1148462558 17:47846941-47846963 CTTCTCTCTGCTCCGGGGACTGG + Exonic
1149017513 17:51925280-51925302 CTACCCTCTGTATCAGGAACAGG + Intronic
1150235495 17:63589750-63589772 CTTCCCTCAGTGCCTGGAGCTGG + Exonic
1151009013 17:70472428-70472450 CTTGTCTCTGTGGCAGGAACTGG - Intergenic
1152489073 17:80616729-80616751 CTTCACTTTGTATCTTGAACTGG + Intronic
1152793951 17:82297857-82297879 CACCTCACTGTACCGGGAACCGG - Intergenic
1152914465 17:83026270-83026292 CTTAGCTTTGTACCTGGAAGTGG - Intronic
1156386537 18:36610116-36610138 CCTCTCTCTGTGCCTGGGGCTGG + Intronic
1157572859 18:48724421-48724443 CTTCTCGCTGTTCTTTGAACAGG + Intronic
1159666545 18:71168381-71168403 GTTCCCTCTGTACTTGGAACTGG - Intergenic
1161456413 19:4371898-4371920 CTCCGCTCTGTGCCTGGCACTGG - Intronic
1162575571 19:11496974-11496996 CTCCTCGCTGTTCCTGGAGCGGG + Intronic
1163016403 19:14458119-14458141 CTTCACTCTGGAGCTGGAAAGGG + Exonic
1163159152 19:15454550-15454572 CTTCTCACCGAACCTGGATCAGG + Exonic
1163364742 19:16869654-16869676 CTTCTCTCAGCAGCTGGACCTGG + Exonic
1165369196 19:35392140-35392162 CTTCTCTCTGTCCCTTGAGCAGG + Intergenic
1165422581 19:35729623-35729645 GGTCTCTCTGTACCTGGCCCAGG - Intronic
1166294980 19:41884472-41884494 CTTCTCTTTCCACCTGGAGCAGG + Exonic
926887055 2:17607427-17607449 CTTCATTCTGTCCCTTGAACAGG - Intronic
927250882 2:20993996-20994018 CTTATCTCTGTACCTGTCATAGG + Intergenic
927381186 2:22480886-22480908 ATTTTCTCTGTCCCTGGAAGTGG + Intergenic
928086075 2:28347252-28347274 ATCCTCTCTGTTCCTGGCACTGG + Intergenic
930666578 2:54105155-54105177 CTTCCCACTGTACTTGGAACAGG + Intronic
930834254 2:55776196-55776218 CTTCATTATGTACCAGGAACTGG - Intergenic
931105976 2:59056175-59056197 CTTCTCTCTGTGCCTTCAAAAGG - Intergenic
931255557 2:60569154-60569176 CTTCTCTCTGTATCAGGGGCTGG + Intergenic
935018808 2:99211195-99211217 CCTCTATCTGTACATGGAATGGG + Intronic
941575640 2:167226779-167226801 CATCTCTCTGGGCCTGAAACAGG + Intronic
942961301 2:181832453-181832475 CTTCTGTCTGTTCCCTGAACTGG + Intergenic
945948433 2:216015992-216016014 CCTCACACTGTAGCTGGAACAGG - Intronic
946345228 2:219104234-219104256 CTTCAGTCTGTACCTGGTCCTGG - Intronic
946641308 2:221786278-221786300 CATCTCTCTCTACCAGGATCAGG + Intergenic
946779410 2:223177575-223177597 CTTCTCTCTCTACTTGGCAATGG - Intronic
947006934 2:225522658-225522680 GTTCTCTCTGTTGCTGGAGCTGG - Intronic
947635346 2:231677913-231677935 CTTCTCTGTGTCCCAGGACCTGG - Intergenic
947922313 2:233888008-233888030 CTCCCCTCTGAACCTGCAACAGG - Intergenic
948294366 2:236849691-236849713 TCTCTCTCTGTGCCTGGAACAGG + Intergenic
1171947212 20:31389360-31389382 CTTCTCTCTTTTCCTGGGACTGG - Intronic
1172826301 20:37789874-37789896 CTTCTCTTTCTAACTGGAACAGG - Intronic
1175336891 20:58202304-58202326 CTTCTCTCTGTATTTCCAACAGG - Intergenic
1175908935 20:62395468-62395490 CCTCTCTGTGGACCTGGATCAGG - Intronic
1176373038 21:6073955-6073977 TTTCCCTCTGTACCTGGAAAGGG + Intergenic
1177497122 21:21903775-21903797 CTTCTTTCTGTGTCTGGAATTGG - Intergenic
1177949028 21:27510733-27510755 CTTCTCTCTATACCTGGTGAAGG - Intergenic
1179750439 21:43464288-43464310 TTTCCCTCTGTACCTGGAAAGGG - Intergenic
1180567143 22:16680737-16680759 CTTTTCTATTTAACTGGAACTGG - Intergenic
1181048515 22:20227838-20227860 CTTCTCACAGTACCAGGAGCTGG - Intergenic
1182246662 22:28963570-28963592 ATTCTCTCTGATCCTGGAGCAGG + Intronic
1182361275 22:29747930-29747952 CTGCTCTCTGCCCTTGGAACAGG + Intronic
950417921 3:12879145-12879167 CTTCTTTCTTCATCTGGAACAGG - Intergenic
950937529 3:16855258-16855280 CTTCTCTCTGAACCACCAACTGG + Intronic
951101666 3:18695002-18695024 GTTTTCTCTGTACCTGAAAATGG + Intergenic
952257375 3:31706981-31707003 CTTCTCTCTTAACCTAGACCTGG + Intronic
953244872 3:41181863-41181885 CTTCTCTCTGTACCTCTATGAGG + Intergenic
955059145 3:55481766-55481788 CTTCTCTCAGTCCGTGGAAGAGG - Intronic
956110793 3:65868082-65868104 TTTCTTTCTCTACCTGAAACAGG - Intronic
960018706 3:112923764-112923786 CTTCTCTGTGTAGCTGGCATAGG + Exonic
962608772 3:137055311-137055333 CCTCTCTCTGACCCAGGAACTGG - Intergenic
965620517 3:170638302-170638324 CCTCTCTCTGGTCTTGGAACAGG + Intronic
966261219 3:177981709-177981731 CCTCTCTCTGGCCCTGGGACTGG + Intergenic
966696724 3:182797259-182797281 CTTTTTCCTGTACCTGTAACTGG + Intronic
969690768 4:8702914-8702936 CTTCTCTTAGTTCCTGGAAGAGG - Intergenic
970541315 4:17082622-17082644 CTTCTTTTTGTCCCTGGAAGAGG + Intergenic
972441701 4:39099916-39099938 ATCATCTGTGTACCTGGAACTGG + Intronic
973967736 4:56181272-56181294 CTGCTTCCTCTACCTGGAACAGG - Intronic
975890054 4:79016947-79016969 CCTCTCTCTGCCCCTGGAGCAGG + Intergenic
977662159 4:99601967-99601989 ATTATCTATGTACCGGGAACTGG - Intronic
978042092 4:104079603-104079625 CCTCTCTCTTTACCAGGACCTGG + Intergenic
978824100 4:113000283-113000305 CATCTCTCTGTACCAGGAAGAGG - Intronic
979145329 4:117239799-117239821 CCTCTCTCTGCTCCTGGTACTGG + Intergenic
979956082 4:126955607-126955629 CTTTGCTCTGCACCTGGAACAGG - Intergenic
981072352 4:140557098-140557120 CATTTCTCTGTACCAGGAATTGG + Intergenic
983616708 4:169714058-169714080 CTGCTCTCTTTTCCTGGACCTGG + Intronic
985422693 4:189800282-189800304 CTTCTCTCTAAAACTGGAGCCGG - Intergenic
986013170 5:3735144-3735166 CTCGTCCCTGTACCTGGAAGAGG - Intergenic
988691713 5:33579073-33579095 CTTCTCCCTGGACCTAGAAAGGG + Intronic
989280705 5:39639843-39639865 ATTATCTCTGTACCTGGAATAGG - Intergenic
990133450 5:52616423-52616445 CTTCTCCATGTACATGAAACTGG - Intergenic
991121716 5:63023570-63023592 TTTCTCTCTGTACCTGGGTCAGG - Intergenic
992658815 5:78937902-78937924 CTTCTCTGTGACCCTGGAAATGG - Intronic
995352567 5:111197560-111197582 CTTCTCTATGATCCTGGAACTGG + Intergenic
997803325 5:136888792-136888814 CTTCTCTATCCTCCTGGAACTGG + Intergenic
997847800 5:137303908-137303930 CTTCTCCTTGTGCCAGGAACCGG + Intronic
999448072 5:151657288-151657310 CTCCTTTCTGTTCCTGAAACAGG - Intergenic
1001210013 5:169801878-169801900 CTTATCTCTGTACCTTGATAAGG + Intronic
1001774646 5:174320099-174320121 CTTCCCTCTGTACCTGCTGCTGG + Intergenic
1002570938 5:180139005-180139027 CTGCTGTCAGTACCTGGCACAGG + Intronic
1008299941 6:49823957-49823979 CTTTTCTCTGTTCCTGCAAATGG - Intergenic
1010616366 6:78017292-78017314 TTTCTCTTTATACCTGGAAGTGG - Intergenic
1011762180 6:90579119-90579141 TTTTTCTCTGTACCAGGCACTGG - Intronic
1014325463 6:119987224-119987246 CTTATCTCTCTCCCTGAAACGGG - Intergenic
1017398464 6:154030938-154030960 CTGCTCTCTGAACCTGCAAATGG + Intronic
1018294257 6:162328832-162328854 CTGCTCTCTGGCCCAGGAACCGG - Intronic
1019012461 6:168852707-168852729 CTTCTCTCTATTCCCGAAACAGG + Intergenic
1019159534 6:170059905-170059927 CTTCTCTTTGTATCCGTAACTGG - Intergenic
1020863968 7:13532681-13532703 CATCTCTCTATTCCTTGAACTGG + Intergenic
1021543270 7:21784306-21784328 CATTTCTCTGTACTTTGAACAGG - Intronic
1022102947 7:27179972-27179994 CTTCTCTCTCTGCCCGGAGCTGG - Exonic
1022580478 7:31548490-31548512 CTTCTTTCTCTAACTGAAACTGG - Intronic
1023891252 7:44393417-44393439 CTCCTCTGTGTCCCTGGGACAGG - Intronic
1024541550 7:50479261-50479283 CTGCTCTCTGTGCCTGGCGCTGG - Intronic
1025206865 7:56998537-56998559 CTTCTCACTGTCCCTAGATCTGG + Intergenic
1025665075 7:63578389-63578411 CTTCTCACTGTCCCTAGATCTGG - Intergenic
1026481371 7:70782462-70782484 CTTTTGTTTGTACCTGGAGCAGG - Intronic
1026545166 7:71316113-71316135 CTTCCCTCTGTGCTTGCAACTGG + Intronic
1028581725 7:92416054-92416076 CTCCTCTCAGTTCATGGAACAGG + Intergenic
1029045724 7:97626148-97626170 CTTCACTCTGGTCCTTGAACAGG + Intergenic
1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG + Intergenic
1031850662 7:126858870-126858892 CTCCTTTCTGTTCCTTGAACAGG + Intronic
1032862902 7:135898479-135898501 CTTCTCTCTGGACCTCAGACTGG - Intergenic
1034818833 7:154198185-154198207 CCTGTCTATGTACCTGGAAAAGG - Intronic
1035298904 7:157884398-157884420 CTCCTCTCTGCACCTGGAAGAGG + Intronic
1037760518 8:21738662-21738684 CTTCTCTCTGTTCCTTGCAGAGG - Intronic
1037926185 8:22845848-22845870 CTCCTCTCTGGACCTGGCACGGG + Intronic
1038311207 8:26447849-26447871 ATATTCTCTGTACCTGGAACAGG - Intronic
1039124180 8:34182381-34182403 TTTCTTTCTCTACCTGGAAAAGG - Intergenic
1039134956 8:34311512-34311534 CCTCTCTCTGTACATGAAACAGG + Intergenic
1044819060 8:96143839-96143861 CCTCTTTCGGTACCAGGAACTGG - Exonic
1045616156 8:103914116-103914138 CATCTCACTGTCCCTGGAAATGG - Intronic
1047655941 8:126977200-126977222 TTTCGCTTTGTACCTGGACCAGG - Intergenic
1048317329 8:133371830-133371852 CCTCTCTGTGGGCCTGGAACAGG - Intergenic
1052784635 9:32817175-32817197 CTTCTCTCTGGTTCTGTAACGGG + Intergenic
1053949874 9:43360093-43360115 CTTTTCGCTGTATCTGGAAGTGG + Intergenic
1056289530 9:85128764-85128786 CTTCTCCCTGTACTGGGAGCAGG + Intergenic
1058956331 9:109952034-109952056 CACCTCTCTTTACCTGGAACAGG + Intronic
1058975395 9:110121414-110121436 CTTCTCTGTGTGCCTTGAATTGG + Intronic
1059917823 9:119123434-119123456 TTTCTCTGTGTACCTTGACCAGG + Intergenic
1060034148 9:120240675-120240697 CTTCTCTGTGTCCCTAGCACTGG - Intergenic
1060647873 9:125297561-125297583 CTTCTTGCTGTTCCTTGAACAGG - Intronic
1060783402 9:126430384-126430406 CTTCTCTCTGTCCCTGGCTGTGG + Intronic
1060800865 9:126545272-126545294 CGTCTCACTCTTCCTGGAACAGG + Intergenic
1062511118 9:136906761-136906783 CTTCTCTGTGTTCCTGTAAGCGG + Intronic
1062615457 9:137394037-137394059 CTGCTCTCTGTGCCGGGGACGGG - Intronic
1203593053 Un_KI270747v1:88294-88316 CTTTTCGCTGTATCTGGAAGTGG + Intergenic
1185760840 X:2689306-2689328 CTTCTCTCTGACCCTAGCACCGG + Intergenic
1187761481 X:22591240-22591262 CCTGTCTCTGTACATGCAACTGG - Intergenic
1190217979 X:48492826-48492848 GTTCTCTCTGTCCCTGTAACAGG + Intergenic
1190572368 X:51796843-51796865 CTTCTCTCTGTGCCTCAGACTGG + Intergenic
1192776541 X:74251484-74251506 CTAAGCTCTGTACCAGGAACAGG - Intergenic
1196653947 X:118197532-118197554 CTTCTCTCAGTACTTGGAGTGGG - Intergenic
1198308695 X:135407507-135407529 CTTTTCTCTGTACCTGCATTAGG + Intergenic