ID: 1132254142

View in Genome Browser
Species Human (GRCh38)
Location 15:100360371-100360393
Sequence GGTCCTCTATGCTGTTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132254142_1132254146 17 Left 1132254142 15:100360371-100360393 CCTATGGAACAGCATAGAGGACC No data
Right 1132254146 15:100360411-100360433 ACTTACAGTCAACTGATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132254142 Original CRISPR GGTCCTCTATGCTGTTCCAT AGG (reversed) Intergenic