ID: 1132266052

View in Genome Browser
Species Human (GRCh38)
Location 15:100471708-100471730
Sequence AGATTATTATATGTGCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132266052_1132266057 24 Left 1132266052 15:100471708-100471730 CCCTGAAGCACATATAATAATCT 0: 1
1: 0
2: 1
3: 16
4: 259
Right 1132266057 15:100471755-100471777 GTCTAATGATGATTACATACAGG 0: 1
1: 0
2: 0
3: 3
4: 76
1132266052_1132266055 -7 Left 1132266052 15:100471708-100471730 CCCTGAAGCACATATAATAATCT 0: 1
1: 0
2: 1
3: 16
4: 259
Right 1132266055 15:100471724-100471746 ATAATCTTGACCTTTAGAATGGG 0: 1
1: 0
2: 2
3: 12
4: 203
1132266052_1132266054 -8 Left 1132266052 15:100471708-100471730 CCCTGAAGCACATATAATAATCT 0: 1
1: 0
2: 1
3: 16
4: 259
Right 1132266054 15:100471723-100471745 AATAATCTTGACCTTTAGAATGG 0: 1
1: 0
2: 2
3: 21
4: 270
1132266052_1132266058 25 Left 1132266052 15:100471708-100471730 CCCTGAAGCACATATAATAATCT 0: 1
1: 0
2: 1
3: 16
4: 259
Right 1132266058 15:100471756-100471778 TCTAATGATGATTACATACAGGG 0: 1
1: 0
2: 1
3: 6
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132266052 Original CRISPR AGATTATTATATGTGCTTCA GGG (reversed) Intronic
902350987 1:15854270-15854292 AGGCTAATATATGTGTTTCAAGG - Intronic
902981655 1:20127585-20127607 AAAATATAAAATGTGCTTCAAGG - Intergenic
904109051 1:28110905-28110927 AAATTATGATTTGTGCTCCAAGG + Intergenic
904574296 1:31493122-31493144 AGATGATGATTAGTGCTTCATGG + Intergenic
904654167 1:32030612-32030634 AGATGATTATATTTCCTTCCTGG - Intronic
905320394 1:37112239-37112261 TGATTATGATATGTACCTCATGG + Intergenic
905721456 1:40206304-40206326 AGATTAGGTTGTGTGCTTCAAGG + Intronic
906443128 1:45868391-45868413 AGATTACTATATGTGCCTTATGG - Intronic
907224541 1:52932795-52932817 AGATTATTATATGTGTAACATGG + Intronic
907630210 1:56073587-56073609 AAATTATTATTTGTTCCTCATGG - Intergenic
909204610 1:72739455-72739477 ACATTGTTATAATTGCTTCATGG - Intergenic
909905802 1:81193135-81193157 TGATTATTATCAGTGTTTCAAGG - Intergenic
910120232 1:83780178-83780200 AAATTATTATATGTGATACATGG - Intergenic
910256555 1:85254071-85254093 AGATTTTAATATTTCCTTCAAGG - Intronic
910525305 1:88171276-88171298 AGTATATTATATGTGCTTTTGGG + Intergenic
911818152 1:102381334-102381356 AGTATATTAAATGTACTTCAGGG - Intergenic
912088864 1:106045066-106045088 AGATTCTTCTATGTTTTTCATGG - Intergenic
914502723 1:148261638-148261660 AAATTATATTTTGTGCTTCAGGG + Intergenic
915517612 1:156422214-156422236 AGAATATTCTTTGTGCTTCTCGG + Intronic
917036851 1:170757534-170757556 AGATTGTTATTAGTACTTCAGGG + Intergenic
917424487 1:174900130-174900152 AAATTACTACATGTACTTCAAGG + Intronic
918377866 1:183927087-183927109 TGATTATGATATGTTCTTTAGGG - Exonic
919127297 1:193410593-193410615 GGATAATAATATGTACTTCATGG + Intergenic
919294305 1:195675336-195675358 ATATTTTTGTATTTGCTTCATGG + Intergenic
920405567 1:205706978-205707000 AGATCATCATTTGTGCTTCTTGG - Intergenic
922180013 1:223226227-223226249 ACATTATTATATATTCATCAAGG - Intronic
922421849 1:225465747-225465769 AGCTGATTCTCTGTGCTTCAGGG + Intergenic
1063019752 10:2115995-2116017 AGGTTGTTATTTCTGCTTCATGG - Intergenic
1064840804 10:19589519-19589541 AGCTTAGTTTATGTGCTTTAGGG - Intronic
1064917226 10:20473295-20473317 AGATTTTTAAATTTGCTTCCTGG + Intergenic
1066213747 10:33265826-33265848 AGATTATGACATGTGCTGTATGG + Intronic
1068058798 10:52040339-52040361 AGATTATGAAATGTGTTACAGGG - Intronic
1068209491 10:53901551-53901573 AGATTATTGTAGATGCTGCATGG - Intronic
1068764069 10:60743696-60743718 ATATGATTATAAGTTCTTCAAGG + Intergenic
1070052445 10:72902466-72902488 ATTTTCTTATATGTGCTTCCAGG + Intronic
1071020090 10:81043479-81043501 AGGTTATAATATGTTCTTCCTGG + Intergenic
1071940295 10:90583795-90583817 AGATTATTATTTGTCCTTCTAGG - Intergenic
1072812877 10:98477179-98477201 GAATTATTCTATATGCTTCATGG + Intronic
1078148776 11:8741234-8741256 AGATTCTTAGATGTGCTTTCTGG - Intronic
1078774054 11:14377931-14377953 AAATAATTATATGAGCTGCAAGG - Intergenic
1081532576 11:43972648-43972670 AGATTAGGAGATGTGCTTTAAGG + Intergenic
1082762821 11:57143758-57143780 ACATGATTCTATGTTCTTCATGG + Intergenic
1087580494 11:100045470-100045492 AGATTTTTATATTTTCTCCATGG - Intronic
1087861316 11:103160822-103160844 TGATTATTATATATGTTTTAGGG + Intronic
1088685064 11:112278011-112278033 ACATTATTATAAGTGGTTCAAGG - Intergenic
1088851774 11:113709383-113709405 AGTTCAATATATGGGCTTCAGGG - Intergenic
1088941005 11:114456050-114456072 CGACTATTATTTGTTCTTCAAGG - Intergenic
1090245918 11:125215864-125215886 GGATGATTATATTTTCTTCAGGG + Intronic
1091323642 11:134668406-134668428 AGATTATAATATCTGTTTTATGG - Intergenic
1093609829 12:21140369-21140391 AGAATATAATGTGTTCTTCATGG - Intronic
1097576341 12:61397496-61397518 TCATTATTATATGTGTTCCATGG - Intergenic
1099698590 12:86055287-86055309 AGATTAATTTCTGGGCTTCAGGG + Intronic
1103220588 12:119241279-119241301 ATATTATTATATCAACTTCAAGG + Intergenic
1103427904 12:120854251-120854273 AGAATTTTTTAGGTGCTTCATGG - Intronic
1105564364 13:21529718-21529740 AGATGATAATATCTACTTCAAGG - Intronic
1106729763 13:32528291-32528313 AGAGGATCATATATGCTTCATGG - Intronic
1109083718 13:57942335-57942357 GGATTATTATGTGTTCTTCCTGG - Intergenic
1110301200 13:73929340-73929362 GGATTATAATATCTGCCTCATGG - Intronic
1110722755 13:78783454-78783476 ATATTGTTATATTTGCTACATGG + Intergenic
1111277392 13:85967831-85967853 ATATTCTTATATGTGCATAAAGG + Intergenic
1111329810 13:86750275-86750297 ACTTTTTTATGTGTGCTTCAAGG - Intergenic
1111376951 13:87392680-87392702 AAATTATTAAATATTCTTCAGGG + Intergenic
1112006337 13:95256973-95256995 ATATTATTCTCTGTGCTTCTTGG - Intronic
1112072242 13:95866655-95866677 AGATTATTTTATGTGGGTCCTGG + Intronic
1112935531 13:104793720-104793742 TGATTATTATAAATCCTTCAAGG + Intergenic
1113185966 13:107685997-107686019 AGCCTATTTTATGTTCTTCATGG - Intronic
1114385455 14:22249682-22249704 AGATTTTTCCATGTGTTTCATGG + Intergenic
1114387540 14:22270461-22270483 AGTTTATTATAGGTGATTCTAGG - Intergenic
1114781268 14:25540716-25540738 AGACTATTTTAAGTGCATCAAGG + Intergenic
1115195967 14:30799706-30799728 GGATTTTTATATGGGGTTCAGGG - Intergenic
1115476391 14:33818046-33818068 ATATTATTATTATTGCTTCATGG - Intergenic
1116373286 14:44163779-44163801 AAATTATCATATTTGCTTGATGG + Intergenic
1116491187 14:45505263-45505285 AGATTAATATACTTGCTTCTTGG + Intergenic
1116785839 14:49288059-49288081 ATATTATTTTATGAACTTCAGGG + Intergenic
1118285943 14:64472664-64472686 ATCTGATTATATGTGCTACATGG + Exonic
1119941090 14:78642394-78642416 ATATTATTTAATGTGCTACATGG - Intronic
1121923184 14:97902611-97902633 AGATTTTAATGTCTGCTTCATGG - Intergenic
1126574412 15:50183043-50183065 AGATCATTATTTGCGATTCAAGG - Intronic
1126652682 15:50940843-50940865 AGATTATTTTATGTGCTTTGAGG + Intronic
1127757420 15:62106111-62106133 ACCATCTTATATGTGCTTCATGG - Intergenic
1128878497 15:71222005-71222027 ACATTTTTTTATGTGCTTAATGG + Intronic
1130412121 15:83655619-83655641 AAAATAGTATATGGGCTTCAGGG + Intronic
1130819957 15:87484662-87484684 AGATGATGATTTGTCCTTCAAGG + Intergenic
1132266052 15:100471708-100471730 AGATTATTATATGTGCTTCAGGG - Intronic
1132357259 15:101180998-101181020 AAATGACTATATTTGCTTCAAGG - Intronic
1136063370 16:27742099-27742121 AGATGATTAGATGGTCTTCAAGG + Intronic
1137313700 16:47293611-47293633 ACATTTTTTTATGTGCTTCTTGG + Intronic
1137538521 16:49345844-49345866 GGAATATTATATCTTCTTCATGG - Intergenic
1137752029 16:50870933-50870955 ACATTATTTCATGTGCTTCTTGG + Intergenic
1138047006 16:53735617-53735639 TGAGAATTTTATGTGCTTCACGG + Intronic
1139023256 16:62779999-62780021 AGTTTTTTATATGAGTTTCATGG - Intergenic
1144470620 17:15537614-15537636 AGTTTTTAATATGTACTTCATGG - Intronic
1145909888 17:28536398-28536420 GGATTATTAAACCTGCTTCATGG + Intronic
1149527944 17:57372107-57372129 ACATTTTTATATGTGCTGAAGGG + Intronic
1151747069 17:76017495-76017517 GCATTATTACATCTGCTTCAGGG + Intronic
1153383651 18:4467862-4467884 AGATTATACTAGGTGCTTGAAGG + Intergenic
1153822427 18:8843811-8843833 AAAGTATTATATATACTTCAGGG - Intergenic
1154239666 18:12641239-12641261 AGTTTATTAAATATGCTTCTGGG + Intronic
1154409954 18:14133636-14133658 TGATTTTTATGTGTGCTTTAGGG - Intergenic
1155728408 18:29119046-29119068 AAAATATAATATGTACTTCAGGG - Intergenic
1156293230 18:35767808-35767830 AGATTATAATAAGTGCTATACGG - Intergenic
1158653769 18:59310047-59310069 AGATTATTAGATGAGCTTTATGG + Intronic
1159519703 18:69503232-69503254 AGATAATTATCTCTGCTTTAAGG - Intronic
1159530625 18:69651246-69651268 AGAAGATTATTTGTGCTTCAAGG - Intronic
1164817391 19:31215333-31215355 AGATTATTTTATGTGCTCTGTGG - Intergenic
1166615618 19:44242352-44242374 AGATTATTATTTCTGAGTCAGGG - Intronic
1167923181 19:52800884-52800906 AAATTATCTTATGTGTTTCAAGG + Exonic
926282867 2:11464757-11464779 AGATTATTATTCTTGTTTCACGG - Intronic
926903507 2:17784213-17784235 AAATTTTTAAATGTGCTTCTTGG - Exonic
927302512 2:21531905-21531927 AGATTATTATTTTTTCTTCTGGG + Intergenic
929327738 2:40637705-40637727 AAATGATGATATGTGTTTCATGG - Intergenic
929372205 2:41239586-41239608 AGATTTTTATATAAGATTCATGG - Intergenic
929742829 2:44621802-44621824 AGATTATTCTTTTTGCTCCATGG + Intronic
929980983 2:46680131-46680153 AGATTTTTTTATGTTGTTCAAGG - Intergenic
930271395 2:49261767-49261789 AGATGAATATATGTGCTGGAGGG + Intergenic
931953053 2:67386728-67386750 AGATTATTAAAAGTAATTCAAGG + Intergenic
932788239 2:74627812-74627834 AGATTTTAATATGCACTTCATGG - Intronic
933424773 2:82096048-82096070 ATATAGTCATATGTGCTTCATGG - Intergenic
933546179 2:83715462-83715484 TGATTATTATATCTTCTTGATGG - Intergenic
933810144 2:86027993-86028015 TGCTGATTATATGTGCTTCGAGG - Exonic
936657130 2:114501230-114501252 ATATTATTATTTTTGCTTTAAGG - Intronic
936990378 2:118357796-118357818 AGATCTTTTTATGTGCTTAATGG + Intergenic
937344578 2:121116960-121116982 ACATTATTATATGTTCATTATGG + Intergenic
937665168 2:124478854-124478876 AAATTATAAAATGTGTTTCAAGG + Intronic
937970524 2:127545713-127545735 AAATAATCATATGTGCCTCACGG + Intronic
939120024 2:138104834-138104856 AGATTTCTATATCTGCTTCTGGG + Intergenic
940033179 2:149286274-149286296 AGAGTATTATATCTGATTCTGGG - Intergenic
940157702 2:150676785-150676807 ACAATGTTATATGTACTTCATGG + Intergenic
940440586 2:153711474-153711496 GGATTATGATAGGTGCTTCTAGG - Intergenic
941454265 2:165696494-165696516 AGATCTTTATATGTCCTCCATGG + Intergenic
943617977 2:190115617-190115639 AGATTAAAATATATGCTTCTTGG - Intronic
943619108 2:190127852-190127874 AGATGGTTTTATGTGGTTCAAGG + Intronic
944311203 2:198235732-198235754 AGATTCATGTATGTGCATCAGGG + Intronic
945413721 2:209544437-209544459 ATTTTATTATATGAGCTTAAGGG + Intronic
946636304 2:221731366-221731388 AGTTCATCAAATGTGCTTCAAGG - Intergenic
1170561409 20:17561811-17561833 AATTTATTAGATGGGCTTCAGGG + Intronic
1171287885 20:23957060-23957082 AGATTATTATATATATTTAAAGG + Intergenic
1171345797 20:24465330-24465352 AGCTTATTCTATGTGCTGCCTGG - Intergenic
1173719382 20:45240468-45240490 TTAATATTATATGTGCTACATGG + Intergenic
1174439073 20:50534314-50534336 AAATAATTAAATGTGTTTCAAGG - Intronic
1177315104 21:19449719-19449741 TGATTTTTGTATGTGCTTTAAGG - Intergenic
1180146859 21:45926032-45926054 AGATGATGAGATGTGCTTTATGG - Intronic
1182037861 22:27213630-27213652 AAATTATGAAATGTGCTCCAAGG + Intergenic
949410778 3:3761839-3761861 AGATTATCACATGTGATTCTAGG - Intronic
949924162 3:9027873-9027895 AGCATATTACATGTGCCTCATGG - Intronic
949991396 3:9582243-9582265 AAATTATTTTTTTTGCTTCATGG + Intergenic
950338680 3:12221960-12221982 AGATTACTATTTGTACCTCAGGG - Intergenic
951056777 3:18156245-18156267 AAATAATAATATATGCTTCATGG + Intronic
951994874 3:28716113-28716135 AGATAAATAAATGTGGTTCATGG + Intergenic
952032433 3:29159942-29159964 AAATTATTGTATGTACTTCCTGG + Intergenic
952211819 3:31235691-31235713 ATATTATTATAGCTGCATCATGG + Intergenic
952250266 3:31646680-31646702 AGATTATTATATTTTGTTTAGGG + Intergenic
956654965 3:71540536-71540558 AGAATACTGTATGTGCTGCAGGG + Intronic
956770261 3:72519938-72519960 ACATTGTTCTAAGTGCTTCATGG - Intergenic
957481758 3:80806915-80806937 AGGTTATTGTATTTGCTTAATGG + Intergenic
958910264 3:99986360-99986382 AGAATAGTATGTGTGCTTCAGGG + Intronic
959253017 3:103972365-103972387 AGATTATCATCTGTGATTTATGG - Intergenic
959795090 3:110417392-110417414 AGTTTTTTATATGTGTTTGAAGG - Intergenic
961989822 3:131176573-131176595 AAATTATTAAATATGCCTCAGGG - Intronic
962243136 3:133768178-133768200 ATATTATTCTATTTGTTTCAGGG - Intronic
962701549 3:138004954-138004976 ATTTTATTTTATGTGCTTCCTGG - Intronic
962877909 3:139550030-139550052 GGATTGTAAAATGTGCTTCAAGG + Intergenic
963178679 3:142329946-142329968 AGTTGTTTATATGTGCTTCATGG - Intronic
963376210 3:144468673-144468695 TGCCTATTATAAGTGCTTCATGG - Intergenic
964232369 3:154486474-154486496 ACATTAATATGTGTGCCTCAGGG + Intergenic
964254777 3:154763840-154763862 AGATTATTATATATATTTAAAGG - Intergenic
965453976 3:168874578-168874600 TGATAATTACATTTGCTTCATGG - Intergenic
967173252 3:186840541-186840563 AGGTTGATGTATGTGCTTCAGGG - Intergenic
967957639 3:194889671-194889693 AAATTATTACTTGAGCTTCAAGG - Intergenic
968099033 3:195953209-195953231 AAATTATTATTACTGCTTCATGG - Intergenic
968306239 3:197653510-197653532 AAATTATTATTACTGCTTCATGG - Intergenic
970911986 4:21287525-21287547 AGATAATTACATATGTTTCAGGG - Intronic
974261961 4:59537045-59537067 ATATCATTATTTATGCTTCAAGG + Intergenic
974765744 4:66343185-66343207 GTATTATTATATCTCCTTCAGGG - Intergenic
975818189 4:78241489-78241511 AGGTGATTATATGTCTTTCATGG - Intronic
977087433 4:92620239-92620261 TGATTTATAGATGTGCTTCAGGG + Intronic
977187773 4:93961771-93961793 TGATCAGTATATGGGCTTCAGGG - Intergenic
977865904 4:102027055-102027077 ATATTAATATATCTACTTCATGG - Intronic
980892115 4:138826947-138826969 ATATTATTATTTGTGATTTATGG - Intergenic
981164191 4:141537650-141537672 AAATTATTATATCTGTTACAGGG - Intergenic
981353430 4:143758607-143758629 AGAGTATTACAAGTTCTTCATGG + Intergenic
981363877 4:143878627-143878649 ATATTAACATATCTGCTTCAGGG + Intronic
982316196 4:154034494-154034516 AGATGATTATAGGTGCCTTATGG - Intergenic
982375941 4:154690629-154690651 ATAGTACTATATGTGGTTCAGGG - Intronic
982762589 4:159304164-159304186 AAATTATTATATGTGATTTTGGG + Intronic
983343413 4:166496173-166496195 AGATTAATATAGATGCATCAGGG - Intergenic
984270515 4:177543383-177543405 ATATCATTATATTTGGTTCAGGG + Intergenic
985037086 4:185851374-185851396 ATATTATTATATTTCCTTAAAGG - Intronic
986561521 5:9065100-9065122 AGACTTTTTTATTTGCTTCAAGG + Intronic
986863099 5:11951160-11951182 AGATTAATAATTGTACTTCAAGG - Intergenic
987542481 5:19273925-19273947 AGATTATTGTCTGGGGTTCATGG + Intergenic
987555466 5:19441042-19441064 AGATTCTAATATGTGCTTTTAGG + Intergenic
988034726 5:25811751-25811773 AGATGATTCTATGTGCTTTCTGG + Intergenic
988699822 5:33662300-33662322 ATATTTTTAAATGTTCTTCAAGG - Intronic
989727349 5:44602541-44602563 ATACTATTATATGTTCTTCCAGG + Intergenic
991310183 5:65230239-65230261 AGATTTTTATATAAGCCTCATGG + Intronic
991639354 5:68737997-68738019 AGAGTATTATGTTTGCATCAGGG - Intergenic
993196206 5:84749943-84749965 ACATTTTTATATGTGACTCAAGG + Intergenic
993252481 5:85547514-85547536 ATATTATAATATTTGCCTCAGGG - Intergenic
995430701 5:112072690-112072712 AGAATATTACATGTGCATGATGG + Intergenic
996572775 5:124950167-124950189 AGCTTTTTAAATGTGCTCCATGG - Intergenic
998344201 5:141447096-141447118 ACATGATTATATGTGCTCCATGG + Intronic
998672538 5:144369809-144369831 AGATGATTTTAAGTGATTCATGG + Intronic
1000189707 5:158898405-158898427 GGTTTATTACATATGCTTCAGGG - Intronic
1000235044 5:159350151-159350173 ACATTATTCTATGTGCTTCTGGG + Intergenic
1000291917 5:159878548-159878570 ACCTTATTATATGTGCTACCTGG - Intergenic
1000465519 5:161570885-161570907 AGATTATAATTTGTACTTCTTGG + Intronic
1001013836 5:168122833-168122855 AAATTATTATTTTTGCCTCAAGG + Intronic
1003737241 6:8890495-8890517 AGGTTATTTTATGGGCTTTAAGG + Intergenic
1003870337 6:10397983-10398005 AAAAAATTATATGCGCTTCATGG - Exonic
1004265143 6:14142847-14142869 AGATTATTATATTAGTTTCTAGG - Intergenic
1004551525 6:16652747-16652769 GGCTTTTAATATGTGCTTCATGG - Intronic
1004767880 6:18751689-18751711 AGATTATAAAATGTGCTAAAGGG + Intergenic
1005403168 6:25456239-25456261 AGATCTATATAGGTGCTTCATGG + Intronic
1009447885 6:63765018-63765040 AGAGTAGTATATGTGGTTAAGGG - Intronic
1010774270 6:79867287-79867309 AGATTATTATTTTTAATTCATGG - Intergenic
1010812098 6:80312719-80312741 AAATCAATATATGTGATTCAGGG - Intronic
1010864238 6:80953494-80953516 AGAGTATTATATATTCTTCATGG - Intergenic
1011968294 6:93188679-93188701 AGCGTATTAAATCTGCTTCATGG + Intergenic
1014042427 6:116844355-116844377 AGATTATTATAAGTGCCTTTTGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1015441772 6:133256125-133256147 CGATTACTATATGAGTTTCAAGG - Intronic
1016034027 6:139367438-139367460 AGTATACTATATGTGCTTTAAGG + Intergenic
1017281119 6:152627243-152627265 TGATAATTATATTTGTTTCAAGG + Intronic
1018014702 6:159701634-159701656 AGGTCATTAAATTTGCTTCATGG - Intronic
1018053246 6:160029938-160029960 AGATTATTTTAAGTAGTTCACGG + Intronic
1018325165 6:162659765-162659787 ACATTATTATATTTTCATCATGG + Intronic
1019101705 6:169635844-169635866 AGATTGATATATTTGCTTCTTGG - Intronic
1021280630 7:18712822-18712844 ATATTATTTTATGTCTTTCAAGG + Intronic
1022753911 7:33263782-33263804 AGATTATTATCTCTGTTTTATGG + Intronic
1022978725 7:35582254-35582276 AGAATTTTATGTTTGCTTCAGGG - Intergenic
1022989354 7:35693380-35693402 AGGTTACTATATATGTTTCAAGG - Intronic
1025797594 7:64754032-64754054 TGATTTTTATATGTGCTTCAGGG + Intergenic
1028572337 7:92304690-92304712 AGATTATTATCTCTTCTACAAGG - Intronic
1029275510 7:99401679-99401701 AGATTATTTTAGCTTCTTCATGG - Intronic
1029317807 7:99730193-99730215 AGAATGTCATATGTGCCTCATGG - Intronic
1031413319 7:121466365-121466387 GGGTTATTATATGAGTTTCAAGG + Intergenic
1032288449 7:130563163-130563185 AGGTTAGTATATGTGATTTATGG - Intronic
1032489454 7:132313229-132313251 ATATTATTTAATGTGTTTCAAGG + Intronic
1032660269 7:133975792-133975814 AGATTATGATATCTACTTCTTGG - Intronic
1033568786 7:142606587-142606609 ATATTATAATATGTTCTTCTAGG - Intergenic
1035303323 7:157912667-157912689 TGATTTTTGTATGTGATTCAAGG + Intronic
1037021007 8:13970094-13970116 AGTTTGTTGTATGTGCTACAAGG + Intergenic
1037524451 8:19711126-19711148 AGATTTTTATATGTCTTTAAAGG + Intronic
1038892494 8:31741869-31741891 ATATTCTTATATGTGCTTCCTGG - Intronic
1039235400 8:35497332-35497354 AGGTTATTAGACCTGCTTCAGGG + Intronic
1040991178 8:53352178-53352200 AGATTTTTATAGGAGCTCCATGG - Intergenic
1042248545 8:66732515-66732537 TAATTTTTATATGTGCTACAAGG - Intronic
1043518215 8:81016349-81016371 AGGTTATTATACCTGCTTTAAGG + Intronic
1043909987 8:85852957-85852979 AGATAATTATCTTTGCTACAAGG + Intergenic
1044557337 8:93577937-93577959 TGCATATTATATGTTCTTCAAGG - Intergenic
1045425148 8:102058816-102058838 AGATTATCATAGGTTTTTCAGGG + Intronic
1046107834 8:109688092-109688114 AGATAATTTTAGGTGGTTCATGG + Intronic
1046816494 8:118590008-118590030 AGATTATTCAAGGTCCTTCAAGG - Intronic
1050087612 9:1982468-1982490 AGAGTATTTTATTTGCTTTAAGG - Intergenic
1050143445 9:2540391-2540413 AAAGTACTATATGTGCTTCTTGG - Intergenic
1050794305 9:9517892-9517914 AGATTATTACAATTGTTTCAAGG - Intronic
1050909229 9:11046216-11046238 GAATTATTTTATGTACTTCAAGG - Intergenic
1051427545 9:16948560-16948582 AAAATCTTAGATGTGCTTCAAGG - Intergenic
1055097441 9:72427917-72427939 ATATTGTTATAGGTACTTCATGG - Intergenic
1055824941 9:80312733-80312755 ATATTATTTTATGTCTTTCATGG - Intergenic
1058237599 9:102511564-102511586 AGATTATCATGTATCCTTCATGG + Intergenic
1060027893 9:120188360-120188382 AGATTATTAAAGGAGCTCCATGG - Intergenic
1061758660 9:132834303-132834325 AGATTTTTTTATGTTCATCAAGG - Intronic
1188548919 X:31339996-31340018 CAATTATTAGATGTGCTTAAAGG + Intronic
1188601118 X:31965369-31965391 TACTTATTATATGTGCTACAGGG - Intronic
1188927412 X:36061729-36061751 AGATGACTATATTTCCTTCAGGG - Intronic
1188958262 X:36460440-36460462 TGCTTATTATATTTGATTCAGGG - Intergenic
1189995638 X:46634527-46634549 AGATTATGATATGGTGTTCAAGG - Intronic
1190124792 X:47694482-47694504 ATACATTTATATGTGCTTCACGG - Intergenic
1190932057 X:54957241-54957263 AAATTCTTATGTGTTCTTCAAGG + Intronic
1192850211 X:74947709-74947731 TGATTAACAAATGTGCTTCATGG - Intergenic
1194090539 X:89579006-89579028 AAAATATTATATGTGCTTCCAGG - Intergenic
1194685999 X:96916587-96916609 ATATTATTATATTTGCTGCATGG + Intronic
1197115897 X:122833434-122833456 ACATTATTTTAAGTGCTTTACGG - Intergenic
1199194006 X:145005506-145005528 AGATAGTAATATTTGCTTCATGG - Intergenic
1200443194 Y:3235066-3235088 AAAATATTATATGTACTTCCAGG - Intergenic