ID: 1132271954

View in Genome Browser
Species Human (GRCh38)
Location 15:100534045-100534067
Sequence GCTCACATGGTGACATGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132271954_1132271958 24 Left 1132271954 15:100534045-100534067 CCAGACCATGTCACCATGTGAGC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1132271958 15:100534092-100534114 TCAGCTCACCACTCCCTCTGAGG 0: 1
1: 0
2: 1
3: 21
4: 255
1132271954_1132271960 29 Left 1132271954 15:100534045-100534067 CCAGACCATGTCACCATGTGAGC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1132271960 15:100534097-100534119 TCACCACTCCCTCTGAGGGCTGG 0: 1
1: 0
2: 0
3: 25
4: 208
1132271954_1132271959 25 Left 1132271954 15:100534045-100534067 CCAGACCATGTCACCATGTGAGC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1132271959 15:100534093-100534115 CAGCTCACCACTCCCTCTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132271954 Original CRISPR GCTCACATGGTGACATGGTC TGG (reversed) Intronic
901038510 1:6350353-6350375 GCTCACCTGCTGACAGGGCCTGG - Intronic
901135715 1:6992871-6992893 TCTGAGATGGTGACATGGTTGGG - Intronic
902155233 1:14479693-14479715 GCTCACAGTGTGAGATGGTGGGG - Intergenic
902251689 1:15157607-15157629 GCATCCGTGGTGACATGGTCAGG + Intronic
903380441 1:22893030-22893052 GCTCACCTTCTGTCATGGTCTGG - Exonic
908782287 1:67701342-67701364 GCTCAGACTGTGACATGGGCTGG + Intergenic
909589901 1:77335939-77335961 ACTCACATGGTGAAAGGGACAGG + Intronic
912401114 1:109394025-109394047 GATCACACAGTGACATGGCCAGG + Intronic
915513392 1:156399486-156399508 GCGCACATGCTCACATGCTCTGG - Intergenic
915772928 1:158448190-158448212 TCTCCCATGCTCACATGGTCAGG + Intergenic
917449854 1:175138448-175138470 GGTGACATGGTGACATGGGAGGG + Intronic
918422339 1:184376801-184376823 TCTCCCATGGTGACAGGGCCTGG + Intergenic
920254602 1:204645966-204645988 GCTAACATAGTGATATGGTTTGG - Intronic
923145355 1:231193993-231194015 CCTCACGTGGTGTCATGGTTTGG - Intronic
923758012 1:236811323-236811345 GCTAACATGTTGATATGGTTTGG - Intronic
924633359 1:245762960-245762982 GCTCACATGCTCACCTGGCCAGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1064934084 10:20660688-20660710 GCTCACATGGTGGAAGGGGCTGG - Intergenic
1065751289 10:28890226-28890248 AATCACATAGTGACATGGTTTGG - Intergenic
1066260395 10:33724178-33724200 TCTCACATGCTGATATGGTTTGG - Intergenic
1066616695 10:37301960-37301982 GCTCAGGTGGTGACAAGGTGAGG + Intronic
1067349699 10:45464854-45464876 TCCCCCATGGTGACGTGGTCTGG - Intronic
1067797959 10:49334361-49334383 GCCCATATGGAGAGATGGTCTGG + Intergenic
1067994505 10:51256416-51256438 GGTAACATGTAGACATGGTCTGG + Intronic
1068280750 10:54865661-54865683 GATCACATTGTGATATGGTTTGG - Intronic
1068288083 10:54965212-54965234 TCTCACATAGTGGCATGGTTTGG + Intronic
1069216523 10:65828250-65828272 GCTTACATAGTGATATGGTTTGG + Intergenic
1070167820 10:73911541-73911563 GCTCTCATGGTGGCGAGGTCGGG - Exonic
1074708086 10:116153404-116153426 TCTCCCATGGTTACCTGGTCAGG + Intronic
1076736154 10:132460031-132460053 CCTAACATGGGGACATTGTCTGG - Intergenic
1079075412 11:17382571-17382593 GGTCTCATGGTGACATTGGCTGG + Intergenic
1084497969 11:69516294-69516316 AATCACATGGTGATATGGTTTGG - Intergenic
1085580095 11:77642848-77642870 TCTCACATGGTTACAAGGTCAGG - Intergenic
1085799930 11:79579985-79580007 ATTCACATGGTGATATGGTTTGG - Intergenic
1088279812 11:108124488-108124510 GATCACCTGGTGAGCTGGTCAGG - Intronic
1089545336 11:119220075-119220097 GATCACAAGGTCACAAGGTCAGG - Intronic
1090712042 11:129395823-129395845 GCTCACTGGGTGACCTGGGCAGG + Intronic
1094160154 12:27381659-27381681 CCGCACATGTTGACATGGTTTGG - Intronic
1094169763 12:27479547-27479569 GATGACATGGTGATATGGTTTGG + Intronic
1095136731 12:38614211-38614233 TCTCACCTGTTGATATGGTCTGG + Intergenic
1095939909 12:47719415-47719437 GCTTATATGGTGATATGGTTTGG + Intronic
1096212841 12:49779606-49779628 CTTCACATGGTGATATGGTTTGG + Intergenic
1097143820 12:56925843-56925865 GCTGACATGGTGAGATGGGCTGG + Intronic
1098594591 12:72256918-72256940 TTTCACATGGTGCCATGTTCAGG - Intronic
1098820493 12:75221833-75221855 CCTCAGATGGTGATATGGTATGG + Intergenic
1101207926 12:102507430-102507452 CCTCACAGGGTGATATGGTTTGG + Intergenic
1101306568 12:103534276-103534298 GCTCACATGCTTACATGCTCTGG + Intergenic
1102893035 12:116576105-116576127 TCACTCATGTTGACATGGTCAGG - Exonic
1106251107 13:27982098-27982120 GCCAACCAGGTGACATGGTCTGG - Intronic
1110604040 13:77410292-77410314 GCTTACATCGTGAGATGGTTTGG - Intergenic
1116638584 14:47431074-47431096 TCACACATTATGACATGGTCAGG - Intronic
1116854032 14:49936313-49936335 GCTAACATGGTGATATGGTTTGG + Intergenic
1118000178 14:61515635-61515657 GGTCATACAGTGACATGGTCTGG - Intronic
1122707873 14:103632766-103632788 GCTCACAGGCTGGCATGGGCAGG + Intronic
1125010624 15:34869476-34869498 GCTCACATGCTGACATTAGCAGG + Intronic
1127578400 15:60314537-60314559 TCTCACATGGTGATATGGTTTGG - Intergenic
1128529447 15:68433728-68433750 GCTCAGAAGTTGACAGGGTCAGG + Intergenic
1128718773 15:69930128-69930150 TGTCACATGGTGACATGGTTTGG - Intergenic
1131052856 15:89359731-89359753 GCTCCCAGGGTGACAGGGTACGG - Intergenic
1131921291 15:97331673-97331695 GGACAGATGGTGACATGGTTTGG + Intergenic
1132030100 15:98432276-98432298 GTTCACACGGTGATATGGTGTGG + Intergenic
1132271954 15:100534045-100534067 GCTCACATGGTGACATGGTCTGG - Intronic
1132423412 15:101693511-101693533 GGTCATATGGTGATATGGTTTGG - Intronic
1133390363 16:5405206-5405228 GCTTCCTTGGTGACATGGTTTGG + Intergenic
1133413562 16:5588615-5588637 GCTCACATGGGGACGTGCTGAGG - Intergenic
1133642474 16:7730532-7730554 GATCATATGGTGATATGGTTTGG - Intergenic
1135993111 16:27229375-27229397 GCTCCCATGGGGCCATGGTCTGG - Intronic
1137888483 16:52132324-52132346 GGTCATATGGTGATATGGTTTGG - Intergenic
1138597596 16:58037327-58037349 GCTCACACGGTCACCTGGGCAGG + Intronic
1138981491 16:62274159-62274181 TTTCACGTGGTGATATGGTCAGG - Intergenic
1139191676 16:64871099-64871121 GCTCACATTATGACATGATAAGG - Intergenic
1139240563 16:65387820-65387842 GTTAACATGGTAACCTGGTCAGG - Intergenic
1140154169 16:72405072-72405094 GCTGGCATGGTGATATGGTTTGG - Intergenic
1140898682 16:79348682-79348704 GCCTGCATGGCGACATGGTCAGG + Intergenic
1141337947 16:83175029-83175051 GCTAGCATGGTGATATGGTTTGG - Intronic
1141960358 16:87402241-87402263 TCACTCATGTTGACATGGTCAGG - Exonic
1146320942 17:31845937-31845959 GCTCACATGATGACATGACTGGG - Intergenic
1150937518 17:69652981-69653003 TCTCACATGATGATATGGTTTGG - Intergenic
1152309618 17:79541893-79541915 GCCCACCTGGTGACATCGGCAGG - Intergenic
1152552647 17:81037525-81037547 GCCCACATGGAGACATAGTCAGG + Intronic
1153037256 18:775373-775395 GCTGACAGGGTGTCTTGGTCTGG - Intronic
1158941731 18:62411163-62411185 ACTCACAGGGTGATATGGTTTGG + Intergenic
1160082492 18:75742232-75742254 CCTCACATGGTGGCATGGCAGGG + Intergenic
1160533818 18:79580719-79580741 CATCACAGGGTGACATGGTTCGG - Intergenic
1165614820 19:37190471-37190493 GATCACAAGGTCACAAGGTCAGG - Intronic
1166657893 19:44625701-44625723 GGACACATGGTGATATGGTTTGG + Intronic
1168638271 19:58013041-58013063 GGTCACCAGGTGACAGGGTCTGG - Intergenic
925073023 2:986195-986217 GCTCATTTGGGGACATGGCCGGG + Intronic
926088748 2:10036530-10036552 TCTCACAGGGTGACTTGGTGTGG - Intergenic
927513404 2:23658362-23658384 GCTGACAGGGTGACAAGATCTGG + Intronic
928415991 2:31092216-31092238 GCTCACATGATCACAAGGTGAGG - Intronic
929323843 2:40581196-40581218 CCTTACATGGTGATATGGTTTGG - Intronic
931582519 2:63792490-63792512 GCTGACATGTTGATATGGTTTGG - Intronic
932012686 2:67994052-67994074 TCTCACCTGGTGATATGGTTTGG + Intergenic
936605743 2:113951130-113951152 AGTAACATAGTGACATGGTCTGG - Intronic
936703349 2:115040221-115040243 GATCACCTGGTGATATGGTTTGG - Intronic
936703376 2:115040559-115040581 GATCACCTGGTGATATGGTTTGG + Intronic
938381978 2:130841723-130841745 GCTCCCCTGGAGACATGGTTAGG + Intronic
939866279 2:147476015-147476037 GCTAAGATGGTGATATGGTTTGG - Intergenic
941698160 2:168575583-168575605 GCTTACAAGGTGATATGGTTTGG - Intronic
943587398 2:189757920-189757942 GCTCACTTAGTGATATGGTTTGG + Intronic
945410077 2:209497388-209497410 GATCACATGCCAACATGGTCAGG - Intronic
947288640 2:228546569-228546591 GCTCACATGGTGGAAGGGGCTGG + Intergenic
948316879 2:237034663-237034685 GCACAAATGGTGAAATGGTGAGG - Intergenic
948773015 2:240261644-240261666 GCTCACCTGCTGATATGGTTTGG + Intergenic
1170499258 20:16957768-16957790 GCTCACATGATCACAAGGTGAGG - Intergenic
1170582619 20:17710608-17710630 GCTCACATGGAAAGAAGGTCTGG - Intronic
1172389923 20:34559413-34559435 TCGCTCATGTTGACATGGTCCGG - Exonic
1173565376 20:44034826-44034848 GCTAACATGTTCACAGGGTCTGG - Intronic
1173912196 20:46678736-46678758 GGTCACATGCTGACACGGTTTGG + Intronic
1176424108 21:6537228-6537250 GCTCCCCTGGTGACACGGCCAGG - Intergenic
1177206241 21:18015109-18015131 TCTCAGATGGTGATATGGTTTGG + Intronic
1177615152 21:23507786-23507808 GGTCACATGGTAACTTGGTGGGG + Intergenic
1179699601 21:43145543-43145565 GCTCCCCTGGTGACACGGCCAGG - Intergenic
1180252015 21:46596281-46596303 GCTCACAGGGTGTCATGCTGTGG + Intergenic
1181274934 22:21682331-21682353 TCTCAAATCGTGCCATGGTCGGG + Intronic
1182633312 22:31704704-31704726 GCACATATGGTAACATGGTGTGG + Exonic
1183045177 22:35213707-35213729 GCTTAGATGATGATATGGTCTGG + Intergenic
1185026471 22:48417024-48417046 GCACACGTGTCGACATGGTCAGG + Intergenic
1185114701 22:48925634-48925656 GCACTCATGGTGACATGCACAGG - Intergenic
949400792 3:3663636-3663658 GCACACATGGTAATATGGTTTGG + Intergenic
950868692 3:16210736-16210758 CCTGACACGGCGACATGGTCAGG - Intronic
953155608 3:40369601-40369623 GATCATATGGTGATATGGTTTGG - Intergenic
955126927 3:56122047-56122069 GGTCACATAGTAACATAGTCTGG + Intronic
957032955 3:75264503-75264525 CCTCACAAGGTGATATGGTTTGG + Intergenic
960227122 3:115181423-115181445 ACTCACATGATCACATGGTGAGG - Intergenic
960895664 3:122502156-122502178 GCTCACAGAGTGACTTGGCCAGG + Intronic
960997536 3:123349897-123349919 GCTTAGAAGGCGACATGGTCTGG - Intronic
961162387 3:124740065-124740087 GCTCACGTGGTGCCAGGCTCAGG + Exonic
962215533 3:133517730-133517752 GCTCACCATGTGACATGCTCTGG + Intergenic
963369417 3:144379383-144379405 ACTCACATGGTCACAAGGTGAGG + Intergenic
968753177 4:2401049-2401071 GCTCACCTGGGGACATTCTCAGG - Intronic
969326237 4:6445907-6445929 TCTCACATGGCCACATGGCCTGG + Intronic
972291647 4:37695299-37695321 GATTACATGTTGACATGGTTTGG - Intergenic
972297785 4:37756773-37756795 CCTTACATGGTGATATGGTTTGG + Intergenic
973641652 4:52908884-52908906 GATCTCATGGTTACATGATCAGG + Intronic
976871825 4:89803571-89803593 GATCATATGGTGATATGGTTAGG + Intronic
977186565 4:93945633-93945655 GAACACATGGACACATGGTCAGG + Intergenic
977223753 4:94370330-94370352 GCTCCAATGGTGAAATGCTCAGG - Intergenic
978921599 4:114189970-114189992 TGTCACATGGTGACATGGTTTGG - Intergenic
981330327 4:143501005-143501027 ACTCACATGGTGATATGGTTTGG + Intergenic
982200398 4:152954714-152954736 GCTCACATGCTCACATGGGAAGG + Intronic
982355920 4:154468438-154468460 GCTAACATAGAGAAATGGTCAGG - Intronic
982525617 4:156474187-156474209 GAACACATGGAGACATGGTGGGG + Intergenic
984615189 4:181889089-181889111 ACTTACATGGTGACATGGTTTGG + Intergenic
984632247 4:182073383-182073405 CCTCACATAGTGATATGGTTTGG - Intergenic
990593634 5:57291821-57291843 GCTGCCATAGTGACAGGGTCAGG - Intergenic
992710919 5:79455267-79455289 GATCAGATGGTGATATGGTTTGG + Intronic
996079734 5:119244093-119244115 CCTCTCCTGGTGCCATGGTCAGG + Intronic
996096116 5:119400900-119400922 ACTCACATGTTCACATGGACAGG - Intergenic
997513846 5:134471536-134471558 GCTCACTTTGTCACATGGGCTGG + Intergenic
998393141 5:141800644-141800666 GCTGACTTGGAGGCATGGTCAGG + Intergenic
1001527950 5:172441958-172441980 GCTCACATAGGGACAGGGGCAGG - Intronic
1001704274 5:173730571-173730593 GGTCACATGGTCACATGGTGGGG + Intergenic
1002573824 5:180160360-180160382 GCTCACAGGGCGACATGCCCAGG - Intronic
1008261142 6:49367591-49367613 TGTCACATGGTGATATGGTTTGG - Intergenic
1009847495 6:69151767-69151789 GCTCACAAGTTGATATGGTTTGG + Intronic
1013804953 6:113986548-113986570 GCTCACATGTTGATATGGTTAGG + Intronic
1014286257 6:119502533-119502555 GCTGATATGGGGACATGGCCTGG - Intergenic
1016745356 6:147573559-147573581 GGTCACATGGTGACATAGTTTGG - Intronic
1017336035 6:153261375-153261397 CCACACATGGTGATATGGTTTGG + Intergenic
1020850288 7:13344700-13344722 GATCACAAGGTCACAAGGTCAGG - Intergenic
1022415118 7:30170812-30170834 GCTCACATGGTGACAGAGCTGGG + Intergenic
1024220847 7:47285275-47285297 GATCACTTGGTGATATGGTTTGG + Intronic
1024617681 7:51129304-51129326 GCTCACATGGTGGAAGGGGCGGG + Intronic
1028348584 7:89814773-89814795 GCTGAACTGGTGCCATGGTCAGG + Intergenic
1028905383 7:96148490-96148512 TCTCACATGGTTACTTGGTTAGG - Intronic
1032619832 7:133517779-133517801 TCTTACATGGTGATATGGTTTGG - Intronic
1032843378 7:135732395-135732417 GTTTAAATGATGACATGGTCGGG + Intronic
1033604401 7:142915301-142915323 ACTCACATGATGACATGGAATGG + Exonic
1036436068 8:8734605-8734627 GCTCACATGGTGGGAGGGGCAGG - Intergenic
1038328054 8:26587405-26587427 GGTGACATGGTGACATGGTCTGG - Intronic
1040287566 8:46108254-46108276 GGCCACAGGGTGGCATGGTCGGG - Intergenic
1040298415 8:46175296-46175318 GGCCACATGGTGGCATGGGCAGG + Intergenic
1040340598 8:46438595-46438617 AGCCACAGGGTGACATGGTCGGG - Intergenic
1041872540 8:62651628-62651650 TCTCACATGGTGATATGGTTTGG + Intronic
1042312808 8:67395798-67395820 GCTAGCCTGGTGATATGGTCAGG + Intergenic
1042750930 8:72156559-72156581 GCTATCATGGTGATATGGTTTGG - Intergenic
1043350801 8:79359050-79359072 TCTCACATGGTGGCAGGGACTGG - Intergenic
1048029122 8:130614246-130614268 GTTCACAGGGTGATATGGTTTGG - Intergenic
1052859243 9:33426778-33426800 GGTGACAAGGTGACAGGGTCGGG + Intergenic
1053025282 9:34724106-34724128 GCTAGCATGGGGACATGGGCTGG + Exonic
1053036810 9:34833168-34833190 GCTAGCATGGGGACATGGGCTGG + Intergenic
1053651824 9:40177052-40177074 GCACACATGGTGGCATGGTTAGG + Intergenic
1053902216 9:42806365-42806387 GCACACATGGTGGCATGGTTAGG + Intergenic
1054532761 9:66199155-66199177 GCACACATGGTGGCATGGTTAGG - Intergenic
1055117055 9:72616232-72616254 GCTCAAACTGTGACAGGGTCAGG + Intronic
1058200101 9:102028419-102028441 GCAGACATGGTGACATGGTTTGG - Intergenic
1058397687 9:104573956-104573978 GGTTACATGGTGATATGGTTTGG + Intergenic
1058770247 9:108224032-108224054 GGTAGCAGGGTGACATGGTCAGG - Intergenic
1059082759 9:111267219-111267241 ACTCACCTGGTGATATGGTTTGG - Intergenic
1059352540 9:113675907-113675929 GCTCACATGGTGACTGGGCTGGG + Intergenic
1060203621 9:121668165-121668187 GCTCAAATGGTGATATGGTTTGG - Intronic
1185823903 X:3230726-3230748 GCTCACATGATCACAAGGTGAGG + Intergenic
1186066226 X:5768079-5768101 TGTCTCATGGTGACATGTTCTGG - Intergenic
1186187255 X:7033284-7033306 ACTCACATGGTCACAAGGTGAGG - Intergenic
1189548510 X:42069371-42069393 GAACACATGGAGACATGGTGGGG + Intergenic
1193412550 X:81182353-81182375 TGTCAGATGGTGACATGGTTTGG + Intronic
1193423148 X:81308435-81308457 GCTCCCATGGTGAAGTGGACAGG + Intergenic
1196611088 X:117715624-117715646 TCTCACAGGATTACATGGTCTGG + Intergenic
1197062541 X:122198542-122198564 ACTCACATGGTCACAAGGTAAGG + Intergenic
1201528765 Y:14967284-14967306 TGTCTCATGGTGACATGTTCTGG + Intergenic
1201716996 Y:17055891-17055913 GCTCACATGATCACAAGGTGTGG - Intergenic