ID: 1132273344

View in Genome Browser
Species Human (GRCh38)
Location 15:100544962-100544984
Sequence GTTGTGTAAGGCGCTGGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273344_1132273356 29 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273356 15:100545014-100545036 TACAGGCTGTTGATAGGAAGGGG No data
1132273344_1132273353 23 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data
1132273344_1132273352 12 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273344_1132273354 27 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273354 15:100545012-100545034 TCTACAGGCTGTTGATAGGAAGG No data
1132273344_1132273350 3 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273344_1132273355 28 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273355 15:100545013-100545035 CTACAGGCTGTTGATAGGAAGGG No data
1132273344_1132273351 4 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273344 Original CRISPR GTTGTGTAAGGCGCTGGGTT CGG (reversed) Intronic
902919970 1:19659882-19659904 GTTGTGTCAGGCCGTGGGGTTGG + Intergenic
904184108 1:28689334-28689356 GTTATGAAAGGAGCTGGGTGCGG + Intronic
906182790 1:43836451-43836473 TCTGTGTAAGGCTCTGGGCTAGG + Intronic
911581883 1:99643743-99643765 GATGTGTCAGGCACTGTGTTAGG + Intergenic
914457077 1:147846059-147846081 ACTGTGTCAGGCGCTAGGTTAGG - Intergenic
916700269 1:167285754-167285776 TTTGTGCAAGGCGCTGTGGTAGG + Intronic
920199885 1:204253075-204253097 CATGTGTGAGGCACTGGGTTAGG - Intronic
921703767 1:218296362-218296384 GTTGTGAAATGAGCTGGGTGTGG + Intronic
924625936 1:245696509-245696531 GTTGTTTTAGCCGCTGGGTTTGG + Intronic
1068949894 10:62766346-62766368 GTTGTGTATGCAGCTAGGTTTGG - Intergenic
1069697494 10:70397721-70397743 GTTGTGTCAGGTGCTGTGCTAGG - Intergenic
1069893362 10:71665709-71665731 GTTGGGTAAGACACTGGGGTTGG - Intronic
1073097538 10:100988926-100988948 ATTGTGGTAGGCGCTGGGTCGGG - Exonic
1074622952 10:115145207-115145229 GTTATATAAGGAGATGGGTTGGG + Intronic
1076692814 10:132232411-132232433 GTGGCGTAAAGCCCTGGGTTTGG + Intronic
1078135337 11:8647483-8647505 CATGTGTCAGGCACTGGGTTGGG - Intronic
1078571515 11:12462040-12462062 CTTGTTTAAGGGACTGGGTTGGG + Intronic
1081613579 11:44577829-44577851 CTTGAGTAGGGCGCCGGGTTGGG + Intronic
1084271361 11:68030961-68030983 GGTGGGGAAGGTGCTGGGTTGGG + Intronic
1087997242 11:104824530-104824552 TTTGTGTATGGCGCTGTGTGGGG - Intergenic
1089402975 11:118175414-118175436 GTGGTGTGATGTGCTGGGTTTGG - Intronic
1089959281 11:122601460-122601482 GTAGAGAAAGGCGCTGGGTCAGG + Intergenic
1095659248 12:44709899-44709921 TTTGTGTAAGGCACTGACTTAGG + Intronic
1100652491 12:96605643-96605665 TTTGTGTCAGGCACTGGTTTGGG + Intronic
1100971742 12:100078458-100078480 GTGGTGTCAGGGGCTGTGTTAGG - Intronic
1101445940 12:104736963-104736985 GTTGTGTAAGTCACAGGGTGAGG - Intronic
1101545755 12:105711091-105711113 GTTCTGGAAGGTGTTGGGTTGGG + Intergenic
1107326114 13:39244769-39244791 GGTGTGCAAGGCCCTGTGTTAGG - Intergenic
1111089151 13:83419630-83419652 GTTGTGTTAGGCATTGGGTCAGG + Intergenic
1112433942 13:99377156-99377178 GGTGTGTCAGGCTCTGTGTTGGG + Intronic
1114487716 14:23073266-23073288 TTTGTGTTAGGCCCTGGGCTAGG - Intronic
1116862873 14:50008435-50008457 GTGCTGTAAGGGTCTGGGTTAGG - Intergenic
1117314741 14:54563698-54563720 CTTGTGCCAGGCACTGGGTTAGG - Intergenic
1117786502 14:59291581-59291603 GGTATGTAAAGCGCAGGGTTGGG - Intronic
1119564535 14:75617143-75617165 GTTGTGTAATGGGTTGGGTATGG + Intronic
1121444530 14:93970140-93970162 GTTGTTTGAGGGGCTGGGGTGGG + Intronic
1123494885 15:20815156-20815178 GGTGTTTAAAGCGCTGGGTGGGG - Intergenic
1123551379 15:21384249-21384271 GGTGTCTAAAGCGCTGGGTGGGG - Intergenic
1123978752 15:25579110-25579132 GCTGTGTAAGGTGCTGTATTAGG + Intergenic
1132273344 15:100544962-100544984 GTTGTGTAAGGCGCTGGGTTCGG - Intronic
1202959720 15_KI270727v1_random:111492-111514 GGTGTCTAAAGCGCTGGGTGGGG - Intergenic
1137548215 16:49418563-49418585 GTTGTGTGAGCCACTGGCTTGGG - Intergenic
1139832185 16:69809130-69809152 GTTGTGCATGTGGCTGGGTTGGG + Intronic
1140030485 16:71334211-71334233 GTTTTGTAAGGAGTTGGGCTTGG - Intergenic
1142179951 16:88663516-88663538 GCTGTGTGAGGCGCTGTGCTGGG + Intergenic
1147561522 17:41512380-41512402 GATATGTCAGGCCCTGGGTTGGG - Intergenic
1150003443 17:61455811-61455833 GCTGTGTGAGGGGCTGTGTTTGG + Intronic
1152919052 17:83056694-83056716 CTTGGGCAAGGCGCTGGGTAGGG - Intergenic
1154017075 18:10628175-10628197 GTTGTGAAAGTGGCTGGGTCCGG - Intergenic
1154187784 18:12201428-12201450 GTTGTGGAAGTGGCTGGGTCCGG + Intergenic
1154452288 18:14487677-14487699 GGTGTCTAAAGCGCTGGGTGGGG - Intergenic
1155176880 18:23308421-23308443 GTTGTGTGAAGAGCAGGGTTTGG - Intronic
1157280286 18:46342444-46342466 GATGTGCAAGGCTCAGGGTTGGG - Intronic
1159881755 18:73864912-73864934 GCCCTGTAAGGAGCTGGGTTTGG - Intergenic
1162515601 19:11145544-11145566 CTTGTGTAAGCTGCTGGTTTTGG - Exonic
1163167728 19:15509166-15509188 GTTGTGTGAGGTCCTGGGGTTGG + Intronic
930217157 2:48708756-48708778 GTTGTCTAAGCCTCTCGGTTTGG + Intronic
931672249 2:64658052-64658074 GTTGTGTAGGGAGCTGGGGATGG - Intronic
944832690 2:203548932-203548954 GTTGAGTTAGGGGCTGGGTTGGG - Intergenic
948624973 2:239263271-239263293 GATGTGTAGGGGGCTGGGCTGGG - Intronic
948624990 2:239263326-239263348 GATGTGCAAGGGGCTGGGATGGG - Intronic
1171325976 20:24293218-24293240 GGAGTGTAAGGCGGTGGGTGGGG + Intergenic
1171426669 20:25052807-25052829 GCTGTGTTAGGCCCTGGGTGGGG - Intronic
1174177107 20:48652075-48652097 GTTGTTTAAGCTGCTGGGTTTGG + Intronic
1174342363 20:49905937-49905959 GCTGGGGAAGGCGCTGGGCTTGG + Exonic
1176443738 21:6800623-6800645 GGTGTCTAAAGCGCTGGGTGGGG + Intergenic
1176821906 21:13665662-13665684 GGTGTCTAAAGCGCTGGGTGGGG + Intergenic
1184957262 22:47898126-47898148 GTTATGTAAGGCTCTGGCTATGG - Intergenic
952552030 3:34489953-34489975 CTTGTGTAAGGCTCTGCTTTTGG - Intergenic
954700284 3:52447246-52447268 GCTGTGTCAGGCCCTGTGTTGGG + Intergenic
955127883 3:56132457-56132479 GTTGTGTAAGGTGCTGGTGGAGG - Intronic
955155933 3:56416591-56416613 GTTGAGTAGGGAGGTGGGTTTGG - Intronic
956107663 3:65837557-65837579 GTTGGGTAAGCAGCTGGGTGGGG - Intronic
964703055 3:159590259-159590281 GTTCTTTAATGCGCTGGGCTGGG - Intronic
967814724 3:193788989-193789011 GTTGTGTAAGGCACAGGGTTGGG + Intergenic
969244492 4:5923664-5923686 TTTGTGGGAGGGGCTGGGTTAGG - Intronic
973116954 4:46473326-46473348 GTTGGGTAAGGAGCTGGCCTAGG - Intronic
976326332 4:83776009-83776031 CTTGTGTCAGGCACTGTGTTGGG + Intergenic
985836965 5:2278706-2278728 CTTGTGTACGACGCTGGGTGGGG - Intergenic
990998227 5:61755122-61755144 GTTTTGTAAGTCTCTGGATTTGG - Intergenic
1008424651 6:51343131-51343153 TGTGTGTCAGGCACTGGGTTAGG - Intergenic
1008558612 6:52700819-52700841 ATTGTGTGAGGAGCTGTGTTAGG + Intergenic
1016189467 6:141245520-141245542 CTTGTGTAAGGCACTGTTTTAGG + Intergenic
1018732145 6:166659357-166659379 GTTCTGGAAGGCTCTGGGTGAGG + Intronic
1019423507 7:962687-962709 GCTGTGTGAGGCCCTGAGTTTGG + Intronic
1019950318 7:4367008-4367030 TTTTTGTAAGGGGCTGGGCTCGG - Intergenic
1020133090 7:5570428-5570450 CTTGAGGAAGGCGCTGGCTTAGG + Intergenic
1020265234 7:6556177-6556199 GTTTTGCAAGGCCCTGGGCTTGG + Intergenic
1021194828 7:17663517-17663539 ACTGTGTAAGGCACTGGGTGTGG + Intergenic
1024242100 7:47443458-47443480 GCTGTGAAAGGCTTTGGGTTAGG - Intronic
1026091146 7:67302136-67302158 GCCCTGTAAGGAGCTGGGTTCGG - Intergenic
1027035864 7:74924861-74924883 GTTGTGGAAGGAGGTGGGTGAGG - Intergenic
1035648219 8:1244603-1244625 GTGGTGTATGGGGCTGGATTTGG - Intergenic
1039947419 8:42141910-42141932 GTTATTTAATGCGATGGGTTTGG + Intergenic
1041834527 8:62196795-62196817 GTTGTGTTAAGCACTGGGCTTGG + Intergenic
1042884503 8:73532896-73532918 GCTGTGGAAGGGGCTGGGTGGGG - Intronic
1044501697 8:92965756-92965778 GTTGAGTAGGGCGCTGGCTGCGG - Intronic
1047454135 8:124993712-124993734 TTTGTGTCAGGCACTGTGTTTGG - Intergenic
1048006746 8:130425728-130425750 GTTATGTCAGGCACTGGGCTAGG + Intronic
1049093689 8:140535301-140535323 GCTGTGCCAGGCGCTGGGGTGGG - Intronic
1053231973 9:36417799-36417821 GTGGTGGAAGTGGCTGGGTTTGG - Intronic
1053453144 9:38210234-38210256 TTGGTGTCAGGCACTGGGTTAGG - Intergenic
1056212114 9:84374337-84374359 GATGTGTAAGGAGCTGTGTGGGG - Intergenic
1057009035 9:91585243-91585265 TTTGTGTCAGGCACTGGCTTAGG - Intronic
1058004859 9:99904046-99904068 GATGTGTAAAGCACTTGGTTAGG - Intergenic
1203525461 Un_GL000213v1:83904-83926 GGTGTCTAAAGCGCTGGGTGGGG - Intergenic
1186028899 X:5345693-5345715 GCTGTTTAAGGCTCTGAGTTGGG + Intergenic
1195712672 X:107786634-107786656 TGTGTGTCAGGCGCTGTGTTAGG + Intronic
1199699689 X:150365843-150365865 TTAGTGTCAGGCGCTGGGTTAGG - Intronic