ID: 1132273345

View in Genome Browser
Species Human (GRCh38)
Location 15:100544967-100544989
Sequence AAGAGGTTGTGTAAGGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273345_1132273350 -2 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273345_1132273356 24 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273356 15:100545014-100545036 TACAGGCTGTTGATAGGAAGGGG No data
1132273345_1132273351 -1 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273345_1132273355 23 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273355 15:100545013-100545035 CTACAGGCTGTTGATAGGAAGGG No data
1132273345_1132273352 7 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273345_1132273354 22 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273354 15:100545012-100545034 TCTACAGGCTGTTGATAGGAAGG No data
1132273345_1132273353 18 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273345 Original CRISPR AAGAGGTTGTGTAAGGCGCT GGG (reversed) Intronic
903945858 1:26961891-26961913 AAGATGTGGTGGGAGGCGCTGGG - Intergenic
908392656 1:63697659-63697681 CAGACGTTGTGCAAGGCACTGGG - Intergenic
914833589 1:151189241-151189263 AATAGGTTGTTTTAGGCTCTAGG - Intronic
1063598324 10:7457663-7457685 AAGAGGTTGTGGAAGGATTTGGG - Intergenic
1066691088 10:38028953-38028975 AAGGGGATGAGTAAGGTGCTAGG - Intronic
1067001607 10:42619725-42619747 AAGGGGATGAGTAAGGTGCTAGG + Intronic
1067457255 10:46427852-46427874 AGGAGGTGGTGTCAGGCCCTGGG + Intergenic
1067629947 10:47956786-47956808 AGGAGGTGGTGTCAGGCCCTGGG - Intergenic
1068484737 10:57643405-57643427 AAGAGGTTTGGTAAGGAGTTAGG + Intergenic
1072785953 10:98282409-98282431 AAAAGGTTGAGTAGGGAGCTGGG - Intergenic
1073097540 10:100988931-100988953 AACAGATTGTGGTAGGCGCTGGG - Exonic
1086151686 11:83618453-83618475 AATAGTTTGTATAAGACGCTAGG + Intronic
1088728047 11:112656739-112656761 CAGAGGTTGTGCTAGGTGCTAGG - Intergenic
1095114808 12:38340632-38340654 AACAGGTTGTCTATGGCTCTGGG - Intergenic
1103718808 12:122962370-122962392 AAGAGGAGGGGTGAGGCGCTGGG + Intronic
1105620186 13:22059058-22059080 AAGAGGGTGTTCAAGGCGCTAGG + Intergenic
1109342632 13:61080507-61080529 AAGACGGTGTGTAAAGAGCTGGG + Intergenic
1112291259 13:98145158-98145180 AAGAGATTCTGGGAGGCGCTGGG - Intronic
1121427709 14:93864527-93864549 AAGAGGTTGTGTAAGATGAGGGG + Intergenic
1124013848 15:25860455-25860477 AAGAGGTGGTGCCAGGCCCTGGG - Intronic
1129672588 15:77615551-77615573 AAGAGGTTGTTGAAGGCGCCGGG + Exonic
1132273345 15:100544967-100544989 AAGAGGTTGTGTAAGGCGCTGGG - Intronic
1135220574 16:20611356-20611378 AGGAGGTTGTTTGAGACGCTGGG + Intronic
1137823471 16:51467380-51467402 AAGACGGTGTTTAAGGGGCTGGG - Intergenic
1141077135 16:81016924-81016946 AGTAGGGTGTGTAAGGAGCTAGG + Intronic
1141967439 16:87455509-87455531 AAGAGCTTCTGTAGGACGCTAGG - Intronic
1143293236 17:5849402-5849424 AACAGGTTGTGGAACGGGCTTGG + Intronic
1146133027 17:30294698-30294720 AAGAAGTTGTGAAAGGGGCCAGG - Intergenic
1160701936 19:511723-511745 AAGTGGTGGTGGATGGCGCTGGG + Intronic
1163091684 19:15024344-15024366 CAGAGGCTGTGTGAGGCGCCAGG + Intergenic
1163777378 19:19226447-19226469 AAGAGGTTGTGTTAGGCCCAGGG - Intronic
1163875193 19:19861994-19862016 CAGAGGTTGTGTAAGGCCCAAGG + Intergenic
1163875453 19:19864080-19864102 CGGAGGTTGTGTAAGGCCCAAGG - Intergenic
1166744271 19:45133019-45133041 AAGAGTTTGAGTTGGGCGCTAGG + Intronic
1166966098 19:46530130-46530152 AACAGGATGTCTAAGGAGCTGGG - Intronic
926217530 2:10914537-10914559 AAGAGGTTGTGAAAAGGGCCCGG - Intergenic
926319076 2:11735690-11735712 AAGGGGTTGTGTTAGGCTCTAGG + Intronic
926850375 2:17190669-17190691 AAGGGGTTGCGTAAGGACCTTGG + Intergenic
935831009 2:107000459-107000481 AAGGGGTTGAGTATGGCGGTCGG + Intergenic
936529318 2:113264582-113264604 AGGATTTTGTGTAAGGTGCTGGG + Intronic
937636156 2:124157395-124157417 AAGAAGCTGTGTTAGGCTCTTGG + Intronic
938654260 2:133414641-133414663 GAGAGGTGGTGTAAGGAGGTTGG - Intronic
942204719 2:173608677-173608699 AACAAATTGTGTAAGGTGCTTGG + Intergenic
942499845 2:176578019-176578041 AGGAGGTTATGTTAGGAGCTAGG + Intergenic
947188347 2:227473878-227473900 ATTAGGTTGTGTAAGGCCCTGGG + Intronic
1169898992 20:10534174-10534196 GAGAGGATTTGTAAGGCCCTGGG + Intronic
1170786364 20:19471047-19471069 CAGAGGGTGTGTCAGGGGCTTGG + Intronic
1171074237 20:22105761-22105783 GAGAAGTTGCGTAAGGTGCTGGG + Intergenic
1173610185 20:44361469-44361491 AAGACATTTTGTAAGGCACTGGG + Intronic
1178439528 21:32587003-32587025 GAGAGGTTGTGTGAGTCCCTGGG + Intronic
1180041240 21:45281395-45281417 CAGAGGTTGTGGAGGGAGCTAGG - Intronic
1180255661 21:46625633-46625655 AAGAGGTTGGGCCAGGTGCTTGG - Intergenic
1181488657 22:23247565-23247587 CAGAGGTTGGGTCAGGGGCTGGG + Intronic
1181992382 22:26847271-26847293 AAGAGGTTGAGTCAGCAGCTGGG - Intergenic
1182044746 22:27265479-27265501 AAGAGGTAGTGTAGGGTCCTGGG + Intergenic
1182922930 22:34096955-34096977 AAGAGGTTGTGCAATCAGCTAGG + Intergenic
1185040291 22:48500548-48500570 AAGGGGGTGTGGAAGGCGCCGGG + Intronic
950357415 3:12423583-12423605 AAGAGGGGGTGGAAGGCACTGGG - Intronic
956004775 3:64766667-64766689 AGGAAGTTGTGTAAGGGGTTTGG + Intergenic
959570809 3:107881639-107881661 AAGACCTTGTGCTAGGCGCTGGG - Intergenic
966223256 3:177571127-177571149 AAGAGGTTGGGTAAGATCCTGGG + Intergenic
972567790 4:40284873-40284895 AAGAGGTGGTCCAAGGTGCTGGG + Intergenic
972786502 4:42331366-42331388 AAGAGGATGGGCAAGGCTCTTGG + Intergenic
994788974 5:104200118-104200140 AAGAGGTGGTGTTAGGGACTGGG + Intergenic
997839045 5:137221537-137221559 AAGATGTTGTGTAAAGGTCTCGG - Intronic
999881798 5:155872921-155872943 AAAATGTTGTGTAAAGGGCTAGG + Intronic
1001369662 5:171185912-171185934 AAAAGATTTTGTAAGGCTCTAGG - Intronic
1003426297 6:6000223-6000245 AAGTGGTTGAGTTAGGCGCCAGG - Intronic
1008137554 6:47794756-47794778 AAGAACTTGTGGAAGGGGCTTGG - Intronic
1013505232 6:110793657-110793679 AACAGGTTGTGAATGGCTCTGGG - Intronic
1014861958 6:126479924-126479946 AAGTGGTTGTGTAAGCAGTTAGG - Intergenic
1019005018 6:168789622-168789644 GAGAGGGTGTGTAAGGAGCAGGG - Intergenic
1021465028 7:20932735-20932757 AACAGATTTTGTGAGGCGCTTGG - Intergenic
1022597240 7:31724311-31724333 AAAAGGTTGTGCAAGGTGATGGG - Intergenic
1023530972 7:41153893-41153915 CAGATGCTGTGTAAGGCACTGGG + Intergenic
1031015513 7:116571662-116571684 AAGAGGTTGTGCAATGTGATGGG - Intergenic
1034910551 7:154994528-154994550 CAGAGATGGTGCAAGGCGCTGGG + Intronic
1041834526 8:62196790-62196812 AAGAAGTTGTGTTAAGCACTGGG + Intergenic
1044569285 8:93699994-93700016 AAGAGATTGTGTTAGACACTGGG - Intronic
1046360226 8:113143780-113143802 AAGAGGTTAAGTAGGGGGCTGGG + Intronic
1048564669 8:135582887-135582909 AAGAGGTTGTCTGAGGCCCAGGG - Intronic
1050763181 9:9098669-9098691 AAGAGTTTATGTAAGTCGATGGG - Intronic
1055035473 9:71813727-71813749 AAGAGGCTGAGTAAGGCCCCAGG + Intronic
1056102661 9:83314642-83314664 AAGAGATTGTGAAGGGCTCTAGG - Intronic
1059460229 9:114424889-114424911 ATGAGGTAGTGTAAGTCACTCGG + Intronic
1187543915 X:20228490-20228512 AAGAAGTAGGGTAAGGCACTGGG - Intronic
1189588535 X:42487514-42487536 TAGAGGCTGTGTAAGGAGCAGGG + Intergenic
1191797125 X:65033518-65033540 AAGGGGGTGTGGAAGGAGCTAGG + Intronic
1192197530 X:69038471-69038493 AGGTGGTTGTGGAAGGAGCTGGG - Intergenic
1193823783 X:86197231-86197253 AGGAGGTTTTGTAAGGCAGTTGG - Intronic
1201074913 Y:10179579-10179601 AAGAGGTTTCGTCAGCCGCTGGG - Intergenic