ID: 1132273346

View in Genome Browser
Species Human (GRCh38)
Location 15:100544968-100544990
Sequence GAAGAGGTTGTGTAAGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273346_1132273353 17 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data
1132273346_1132273351 -2 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273346_1132273356 23 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273356 15:100545014-100545036 TACAGGCTGTTGATAGGAAGGGG No data
1132273346_1132273354 21 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273354 15:100545012-100545034 TCTACAGGCTGTTGATAGGAAGG No data
1132273346_1132273355 22 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273355 15:100545013-100545035 CTACAGGCTGTTGATAGGAAGGG No data
1132273346_1132273350 -3 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273346_1132273352 6 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273346 Original CRISPR GAAGAGGTTGTGTAAGGCGC TGG (reversed) Intronic
900229832 1:1551016-1551038 GTAGAGGTTGTTGAAGGCCCGGG - Intronic
901253327 1:7798317-7798339 TAAGAGGTTGTGTAAAGAACTGG - Intronic
903174698 1:21573923-21573945 GAATAGGTTGTGGAAGGAGACGG + Intronic
903578626 1:24354544-24354566 GGAGAGGTTGTGTGTGGCGTGGG - Intronic
903857327 1:26344898-26344920 AAAGAGGTTGTGAAGGGCCCTGG - Exonic
903857355 1:26345000-26345022 AAAGAGGTTGTGAAGGGCCCTGG - Exonic
914948062 1:152084322-152084344 GAAAAGTTTGTGTAAGGAGTGGG + Exonic
922908246 1:229192936-229192958 GAAGAGCTTGTGTCAGGAGTAGG - Intergenic
923113382 1:230911139-230911161 GAAGAGGTTCAGTAAGAGGCTGG + Intronic
1064096109 10:12425596-12425618 GAAGAGGTTCTGGAGGGCGTAGG - Intronic
1065916378 10:30357559-30357581 GAAGGGGTTGTGTGTGGGGCTGG + Intronic
1066244263 10:33567147-33567169 GAAGAGGTTTTGTAAAATGCCGG - Intergenic
1072785954 10:98282410-98282432 GAAAAGGTTGAGTAGGGAGCTGG - Intergenic
1074152711 10:110771758-110771780 GAGGAGGTTGTGTAGGGAGAGGG + Intronic
1076692124 10:132229221-132229243 GCAGAGGTTGTGGAAGGCCTTGG - Intronic
1077495648 11:2885388-2885410 GAAGAGGCTGCGGCAGGCGCTGG + Exonic
1082666679 11:55983097-55983119 GAAGAGTTTGTGTGGGGAGCAGG + Intergenic
1088016861 11:105071438-105071460 GAAAGAGTTGTGGAAGGCGCTGG - Intronic
1088885038 11:113999535-113999557 GCAGAGGTTGTGTACTGCACAGG + Intergenic
1089923511 11:122232615-122232637 GAAGAGATTGTAAAAGGGGCCGG - Intergenic
1091446707 12:547926-547948 GATGAGGGAGTGTAAGGTGCTGG + Intronic
1096588720 12:52643338-52643360 GAAGAAGTGGTGTGAGGAGCTGG - Intergenic
1102248190 12:111368408-111368430 GAAGAGGGTGTGGCAGGCACAGG + Intronic
1104318408 12:127725829-127725851 GATGAAGTTGTCTAAGGCTCAGG + Intergenic
1105945227 13:25183906-25183928 GAAGAAGTTGTGGAAGGAGGAGG - Intergenic
1108756802 13:53512873-53512895 GAAGAAGTTGGGTTAGGCCCAGG + Intergenic
1112188456 13:97150911-97150933 GAGGATGTTGTGTTAGGGGCAGG - Intergenic
1117197566 14:53355712-53355734 GGAGGGGTTGTGGAAGGCGGGGG + Intergenic
1118305801 14:64654217-64654239 GAAGAGGTTGAGTAACTTGCTGG + Intergenic
1121427708 14:93864526-93864548 AAAGAGGTTGTGTAAGATGAGGG + Intergenic
1124013849 15:25860456-25860478 GAAGAGGTGGTGCCAGGCCCTGG - Intronic
1124369189 15:29093830-29093852 GAGGAGGTTGTGTATGGTGAGGG - Intronic
1128150832 15:65362603-65362625 GGAGAGGATGAGTAAGGCCCAGG - Intronic
1129672587 15:77615550-77615572 GAAGAGGTTGTTGAAGGCGCCGG + Exonic
1132273346 15:100544968-100544990 GAAGAGGTTGTGTAAGGCGCTGG - Intronic
1141727395 16:85799134-85799156 GAAGAGGGTGTGGTGGGCGCCGG + Exonic
1149639032 17:58191404-58191426 GAGGAGGCTGTGGAAGGCACCGG + Intergenic
1154205135 18:12329668-12329690 GAAGAATTTGTGGAAGGCACTGG - Exonic
1155105093 18:22656067-22656089 GAAGAATTTGTGTAAGGTGAAGG - Intergenic
1157810257 18:50690049-50690071 GAAGAGTTTGGGGAAGGGGCTGG + Intronic
1159955020 18:74513013-74513035 GGAGAGCTTGTGGAAGGTGCGGG - Intronic
1160701935 19:511722-511744 GAAGTGGTGGTGGATGGCGCTGG + Intronic
1161741206 19:6022125-6022147 GCAGGGGTTGTGGGAGGCGCAGG + Intronic
1163716883 19:18878171-18878193 CAGGAGGTTGTGGAAGGCCCTGG - Exonic
1163777379 19:19226448-19226470 GAAGAGGTTGTGTTAGGCCCAGG - Intronic
1166190343 19:41172704-41172726 TAAGAGGGAGTGTATGGCGCTGG - Intergenic
1166966099 19:46530131-46530153 GAACAGGATGTCTAAGGAGCTGG - Intronic
1167203798 19:48086347-48086369 GAAGAGTTTGTGTAGGGAGTGGG - Intronic
925493799 2:4423910-4423932 GGAGAGGTTGGGTAAAGCGGGGG + Intergenic
925711873 2:6748966-6748988 GAAGAGGTTGGGACAGGAGCTGG - Intergenic
936776924 2:115985172-115985194 GAAGAGTTTGTGTAGGGAGTGGG + Intergenic
947188346 2:227473877-227473899 TATTAGGTTGTGTAAGGCCCTGG + Intronic
947867622 2:233410552-233410574 TAAGAGGTTGTGTACTGCCCTGG - Intronic
948352679 2:237353831-237353853 GAAGAGGCTGTTTAAGGAGACGG + Intronic
1171074236 20:22105760-22105782 GGAGAAGTTGCGTAAGGTGCTGG + Intergenic
1173613936 20:44390595-44390617 GAAGAGGTTGTGCACTGTGCGGG + Intronic
1179790032 21:43750992-43751014 GAAGAGCTATTGTAAGGCGGTGG + Intronic
1180657641 22:17436706-17436728 GAAGAGGTTGTATAAATAGCGGG + Intronic
1181488656 22:23247564-23247586 GCAGAGGTTGGGTCAGGGGCTGG + Intronic
1185010053 22:48307759-48307781 GCAGAGGTTGTGTGATGCCCTGG - Intergenic
1185040290 22:48500547-48500569 GAAGGGGGTGTGGAAGGCGCCGG + Intronic
949586377 3:5442502-5442524 GAAGAGGTTGTGTAAGTACACGG + Intergenic
950357416 3:12423584-12423606 GAAGAGGGGGTGGAAGGCACTGG - Intronic
955127885 3:56132463-56132485 AGGGAGGTTGTGTAAGGTGCTGG - Intronic
964472100 3:157066865-157066887 GAAGCTGCTGTGTAAGGTGCTGG - Intergenic
974209369 4:58749734-58749756 GAAGAGAGTGTGTAGGGCGGGGG + Intergenic
979536274 4:121823803-121823825 GAGGAGGTTGCGAAAGGCGCAGG + Exonic
981288334 4:143045816-143045838 GAAGAGGTTGTGGTTGGCACTGG - Intergenic
986108095 5:4680060-4680082 GTAGAGGGTGTGTATGGCTCAGG - Intergenic
986122549 5:4855323-4855345 GAAGAGGTTGTGAAAGGTGAGGG - Intergenic
986751814 5:10794465-10794487 GGAGAAGTTGTGTATGGCGGAGG + Intergenic
989401194 5:41009378-41009400 AAAGACATTGTGGAAGGCGCTGG - Exonic
998169318 5:139863276-139863298 GAAAAGGTAGTGTAAAGTGCTGG - Intronic
999266761 5:150271569-150271591 GGAGATGTTGTGTGAGGGGCTGG - Intronic
1004524282 6:16391758-16391780 GAAGAGGCTGTGCAAGGTGGTGG + Intronic
1007686869 6:43672260-43672282 GAAGAGCTGATGTAAGGCTCTGG + Exonic
1007822868 6:44573989-44574011 GAAGAAATTGTGGAAGGAGCAGG + Intergenic
1009737282 6:67692135-67692157 GAAAATGTTGTGGAAGGCACTGG - Intergenic
1013367210 6:109445415-109445437 GAAGAGGTTCTGCAAGGCCCAGG - Exonic
1017495482 6:154979539-154979561 GAGGAGGTTGTGTATGGAGTGGG - Intronic
1019005019 6:168789623-168789645 AGAGAGGGTGTGTAAGGAGCAGG - Intergenic
1020082041 7:5291421-5291443 GAAGAGCTTGGGCAAGGCCCAGG - Intronic
1026115032 7:67488888-67488910 GAAGAGTTTGTGGAAGGTTCAGG + Intergenic
1027642627 7:80756166-80756188 GAAGAGACTGTGAAAGGAGCAGG - Intronic
1028461824 7:91102775-91102797 GAAGAGGTTCTTTAAGGACCAGG + Intronic
1030928900 7:115497426-115497448 GAAGAGGTTGTGGAAGAAGGTGG + Intergenic
1034910550 7:154994527-154994549 GCAGAGATGGTGCAAGGCGCTGG + Intronic
1044569286 8:93699995-93700017 GAAGAGATTGTGTTAGACACTGG - Intronic
1046806138 8:118480873-118480895 GAAGAGGTTGAGAAAGGCCTGGG - Intronic
1048564670 8:135582888-135582910 GAAGAGGTTGTCTGAGGCCCAGG - Intronic
1049172806 8:141172472-141172494 GAAGAAGCTGTGTCAGGCTCTGG + Intronic
1052033927 9:23659066-23659088 GAAGAGGGTGTGGAGAGCGCCGG + Intergenic
1052068041 9:24047182-24047204 GAAGAGGCTGTGTAGGGTGTAGG - Intergenic
1055300231 9:74875216-74875238 GAAGAGTTGCTGTAAGGTGCAGG - Intronic
1187543916 X:20228491-20228513 GAAGAAGTAGGGTAAGGCACTGG - Intronic
1187622938 X:21078819-21078841 AAAGAGGTTGTGTTAGGCGCTGG - Intergenic
1189588534 X:42487513-42487535 TTAGAGGCTGTGTAAGGAGCAGG + Intergenic
1192197531 X:69038472-69038494 GAGGTGGTTGTGGAAGGAGCTGG - Intergenic
1192212011 X:69133659-69133681 GAGGAGGTGGTGGAAGCCGCAGG - Intergenic
1201074914 Y:10179580-10179602 GAAGAGGTTTCGTCAGCCGCTGG - Intergenic
1202368133 Y:24180523-24180545 GAGGGGGTTGTGTGAGGGGCTGG - Intergenic
1202372563 Y:24208659-24208681 GAGGGGGTTGTGTGAGGGGCTGG + Intergenic
1202498221 Y:25461461-25461483 GAGGGGGTTGTGTGAGGGGCTGG - Intergenic
1202502652 Y:25489594-25489616 GAGGGGGTTGTGTGAGGGGCTGG + Intergenic