ID: 1132273347

View in Genome Browser
Species Human (GRCh38)
Location 15:100544974-100544996
Sequence CCTTCTGAAGAGGTTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273347_1132273350 -9 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273347_1132273354 15 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273354 15:100545012-100545034 TCTACAGGCTGTTGATAGGAAGG No data
1132273347_1132273356 17 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273356 15:100545014-100545036 TACAGGCTGTTGATAGGAAGGGG No data
1132273347_1132273355 16 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273355 15:100545013-100545035 CTACAGGCTGTTGATAGGAAGGG No data
1132273347_1132273352 0 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273347_1132273353 11 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data
1132273347_1132273351 -8 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273347_1132273357 29 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273357 15:100545026-100545048 ATAGGAAGGGGAAGCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273347 Original CRISPR CCTTCTGAAGAGGTTGTGTA AGG (reversed) Intronic
901120157 1:6885020-6885042 CCATCTGATGAGGAAGTGTATGG + Intronic
902203854 1:14853104-14853126 CCTCCAGAAGAGTTTGTGAAAGG - Intronic
902739943 1:18430776-18430798 TCTTGGGAAGAGGTGGTGTAGGG - Intergenic
903046177 1:20565895-20565917 CCTTCTGCGGAGGTTGGGGAAGG + Intergenic
906346349 1:45017714-45017736 GCTCCTGAAGAGGCTGTGTGAGG + Exonic
908070209 1:60452206-60452228 CCTTCTGAAGGGCTTGTTGATGG + Intergenic
910568702 1:88676422-88676444 CCTTCTGAAAAGGTTTCTTAGGG - Intergenic
914559291 1:148801915-148801937 CCATCTGAAAAGGTTGCATATGG + Intergenic
914613542 1:149328308-149328330 CCATCTGAAAAGGTTGCATATGG - Intergenic
915428391 1:155846174-155846196 CTTGTTGATGAGGTTGTGTAGGG - Intronic
918077028 1:181178337-181178359 CTTTCTGAGGAGGATGTGTGGGG + Intergenic
920833085 1:209482640-209482662 CCTTGTGAAATGGTTGTCTATGG + Intergenic
920902342 1:210123307-210123329 CCTTCTGAAGACATTGTGGGTGG + Intronic
921263281 1:213402388-213402410 CCATCTGAAGAGGTTGAGGAGGG - Intergenic
922372112 1:224922070-224922092 TCTAATGAAGAGGTTGTGTGCGG - Intronic
1063188575 10:3671742-3671764 CCTCTTGAAGAGGTGGTGGAGGG + Intergenic
1065999702 10:31092762-31092784 CCTTCTGAAGTGGCTCTGTTGGG - Intergenic
1068404494 10:56572304-56572326 TCTTCTCAAAAGGATGTGTATGG - Intergenic
1074277234 10:112015115-112015137 ACTTCTGCAGAGGTTGGGGAAGG - Intergenic
1077885656 11:6385750-6385772 CTTGCTGAAGAGGGTATGTATGG + Intergenic
1079949039 11:26778975-26778997 CCTTTCGAAGAGGTTGAATAAGG + Intergenic
1081654412 11:44848144-44848166 CCTTTTGAAGAGGCTGTGTTAGG + Intronic
1082660282 11:55900829-55900851 CCTTCTCTAGAAGTTGTGTCTGG + Intergenic
1082718357 11:56642776-56642798 CCTTCTCCAGAAGTTGTGTCTGG - Intergenic
1084056970 11:66640579-66640601 CCCTTTAAAGAGTTTGTGTAAGG - Intronic
1085235330 11:75010048-75010070 CCTACTGAAGAGGTGGATTATGG - Exonic
1089956906 11:122579865-122579887 ACTTCCAAAGAGCTTGTGTATGG - Intergenic
1091358116 11:134953838-134953860 CCATCTGAAGAGGGTGGGTCTGG - Intergenic
1095991049 12:48034819-48034841 GGTTCTGAGGAGGTTGTTTAAGG + Intergenic
1097884633 12:64716715-64716737 CCATCTGCAGAGGCTGTGTGAGG + Exonic
1097965020 12:65569990-65570012 CCTTCTGAAGAGTTGGAGTTGGG - Intergenic
1101654642 12:106709026-106709048 GCTTTTGAAGAGCTTGTGTGAGG - Intronic
1102026121 12:109715037-109715059 CCATCTGAACAAGTTGTGTTTGG - Intronic
1102509203 12:113402847-113402869 ACTTCAGAAGAGGTTGTGCCCGG + Intronic
1103902537 12:124310820-124310842 CTTTCTGAAGGGGCTGTGGATGG + Intronic
1105646699 13:22326854-22326876 CTTTGTGAAGTGGTTGTGTCGGG - Intergenic
1110576389 13:77060700-77060722 GCTTCTGAAGGTGTTGTGAATGG - Intronic
1113175560 13:107559550-107559572 CGGTCTGCAGAGGTTGTATACGG + Intronic
1115020217 14:28670703-28670725 CTTTCTCAAGAACTTGTGTAAGG - Intergenic
1117002828 14:51388967-51388989 TCTTCTGCAGAGGTAGTGCAGGG + Intergenic
1117116059 14:52513714-52513736 CTTACTGAACAGGATGTGTAAGG + Intronic
1117470905 14:56043650-56043672 CCTTGTTAAGAGGTTGTTCATGG - Intergenic
1117886217 14:60366342-60366364 ACTGCTGAAGAGATTGTATAAGG + Intergenic
1122490433 14:102111572-102111594 CCTTCTCAAGAAGCTGTGAAAGG - Intronic
1122588646 14:102829227-102829249 CATTCTGAAAAGCTTGTGAATGG + Intronic
1122654664 14:103249896-103249918 TCTTCTTAAGAGGTTGGGTCTGG + Intergenic
1122849869 14:104522347-104522369 CCATCTAAGGAGGTTGTGCAGGG + Intronic
1127573198 15:60264234-60264256 CCCACTGAACAGGGTGTGTAGGG - Intergenic
1132273347 15:100544974-100544996 CCTTCTGAAGAGGTTGTGTAAGG - Intronic
1134347413 16:13403692-13403714 TCTTCTGAGTAGGTTGTGTAAGG + Intergenic
1137319344 16:47363531-47363553 CATTTAGAAAAGGTTGTGTATGG - Intronic
1140785942 16:78342336-78342358 CCTTCACGAGTGGTTGTGTAGGG - Intronic
1141429592 16:83964847-83964869 CCCTCAGGAGAGGTGGTGTAGGG - Intronic
1142922174 17:3198411-3198433 CTTGCTGAAGAGTTTCTGTAGGG - Exonic
1143593185 17:7898249-7898271 CTTGCTAAAGAGGTAGTGTAAGG + Intronic
1145906910 17:28521390-28521412 CCTTCTCAGGAGGTGGTGCAGGG - Intronic
1150531335 17:65985565-65985587 GCTTCAGAAGAAGTTGTCTATGG + Intronic
1150566841 17:66349573-66349595 CCTTTTGAACAGTTTGGGTATGG + Intronic
1156207434 18:34901420-34901442 ACTTGTGAAAAGATTGTGTATGG + Intergenic
1157187281 18:45551498-45551520 CCTTCTGACCAGGTTCTGTCTGG + Intronic
1157899314 18:51498810-51498832 CCTTCTGAAGCCTTTGTGTTTGG - Intergenic
1158399457 18:57108323-57108345 TTTTCTGAATAGGTTGTGCATGG - Intergenic
1160140187 18:76314301-76314323 CCCTCCGTAGAGGGTGTGTATGG - Intergenic
1162482365 19:10935646-10935668 CCTTCCTAAGTGGTTGTGGAGGG + Intergenic
1163607315 19:18282121-18282143 CCTTCTGGAGAGGCTTTGTGCGG + Intergenic
1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG + Intronic
926750560 2:16195703-16195725 CCTTCTGAAGAGGATGTGTTGGG + Intergenic
926777987 2:16441010-16441032 CCTTATGGAGAGGCTGTGTCAGG - Intergenic
926871396 2:17421882-17421904 TTTTGTGAAGAGTTTGTGTAAGG - Intergenic
927458123 2:23275085-23275107 ACTTCTGAAGAGGTTGTGCAAGG - Intergenic
929401003 2:41581641-41581663 CTTCCTGAATAGTTTGTGTAGGG - Intergenic
930956718 2:57211518-57211540 CCTTCAGAAGAGGTGGAGAAAGG + Intergenic
931024735 2:58097922-58097944 CCTTCTGAAGGGCCTGTGTGAGG - Intronic
934086771 2:88516383-88516405 CCTTCTGAAGTGGTAAAGTAGGG - Intergenic
935657117 2:105433088-105433110 CCTTCTCAAGAGGCTGGGAAGGG - Intronic
935846177 2:107168024-107168046 ACTCCTGAAGAGGGTGTGAATGG - Intergenic
936776922 2:115985166-115985188 GCTGCAGAAGAGTTTGTGTAGGG + Intergenic
938720974 2:134066302-134066324 CCCTTTGAAGAAGTTGTGAATGG - Intergenic
938821219 2:134962181-134962203 CCTTTTGAAGAGGGTCTGAAAGG - Intergenic
947356459 2:229300884-229300906 CCTACTGAGGAAGTTGTGAAGGG - Intergenic
1170555404 20:17510892-17510914 CCTTCTTCAGAGGTTGTGGTAGG - Intronic
1170789334 20:19494857-19494879 CCAACTGAAGAGGTTGTCTCGGG + Intronic
1170969783 20:21105628-21105650 TCTCCTGAAGAGGTCGTTTAGGG - Intergenic
1174621321 20:51876787-51876809 CCCTCTGAAGCGCTTGTGTCAGG - Intergenic
1175514662 20:59561324-59561346 ACTGCTGAAGATGCTGTGTAGGG + Intergenic
1178495408 21:33081743-33081765 CCAGCTGAAGAGGCTGTTTAGGG - Intergenic
1179261571 21:39762784-39762806 CCCTCTGATGAGGGTTTGTAGGG + Intronic
1179827895 21:43978155-43978177 TCTCCTGAAGAGGCTGTGGAAGG + Intronic
1180668519 22:17534405-17534427 CTTTCTGAAGAAGTTGTAGATGG + Intronic
1181761022 22:25058949-25058971 CCTTATGCAGAGGTGGTGTCAGG - Intronic
952642053 3:35609164-35609186 CCTTATAAAGAGGTTTTGAATGG + Intergenic
952644736 3:35641036-35641058 CCTCCTGAAGATGTAGGGTAAGG + Intronic
956330988 3:68108067-68108089 ACTTCTGACCAGGTTGTTTAAGG + Intronic
959115674 3:102175233-102175255 TCTTCAGAAGAGGTTATTTATGG + Intronic
961009542 3:123426639-123426661 CATTCTAAAGAGGTTATGGACGG + Intronic
962531307 3:136283391-136283413 CCTTCTGTGGAGGGTGTGGAGGG + Intronic
964809015 3:160642202-160642224 ACTTCTGAAGAGGGAGGGTAGGG + Intergenic
965864216 3:173184397-173184419 TCTTCAGAGGAGGTTGTGTTAGG - Intergenic
969975367 4:11095162-11095184 CCTTCAAAAGACATTGTGTAGGG + Intergenic
975478972 4:74856837-74856859 CCTTATGGAGAGGCTGTCTATGG - Intergenic
977767126 4:100812174-100812196 GCTCCTGAAGAGGTTGTGTGTGG + Intronic
978789027 4:112641409-112641431 CCTTTGGAGGAGTTTGTGTAAGG + Intronic
979945360 4:126824644-126824666 CCCTCCGAAGAGTATGTGTATGG + Intergenic
980267913 4:130543653-130543675 CCTTCAGAAGACGTTTTGTATGG + Intergenic
980735014 4:136873628-136873650 CGTTCAGAAGAGTTTGTTTATGG + Intergenic
981288335 4:143045822-143045844 CTGTCTGAAGAGGTTGTGGTTGG - Intergenic
982793159 4:159615802-159615824 CTTTTTGAAGAGCTTGAGTATGG + Intergenic
983047605 4:163005351-163005373 CCTTCTCAAGAGGCTTTGGAAGG - Intergenic
988429706 5:31105238-31105260 CCTTCTGTAGAAGATGAGTATGG - Intergenic
988797635 5:34666712-34666734 CCATCTGAAGAGCTTCTGTCAGG - Intronic
989577407 5:43001025-43001047 CCTGCTGATGACGTTGAGTAAGG + Intergenic
991387255 5:66103951-66103973 CCTTCTGCAGAGTTTGGGTTTGG - Intergenic
991563512 5:67981026-67981048 TCTTCTGGAGAGCTTGTGTTTGG - Intergenic
992015037 5:72567037-72567059 CCTTCAGAAGGGGCTGTGGATGG - Intergenic
997555114 5:134790723-134790745 CCTCCTGAAGAAGTTTTGTGAGG - Intronic
997869841 5:137497919-137497941 CCTACTGGAGAGGTTGGGTCTGG - Intronic
998930469 5:147175788-147175810 CCTGCTGCAGAGGTTTTGTTTGG + Intergenic
1001459895 5:171902490-171902512 GCCTCTGAAAAGATTGTGTATGG - Intronic
1005945051 6:30589361-30589383 CCTTCAGAAAAGTTGGTGTATGG + Intronic
1007671908 6:43562285-43562307 CTTTCTGAAGAGGCTCTGTCAGG - Exonic
1008888934 6:56463035-56463057 CCATCTGCAGAGGTATTGTAAGG - Exonic
1008911128 6:56734567-56734589 CCTTCTGTAAATCTTGTGTAAGG - Intronic
1011981930 6:93389313-93389335 CTATTTCAAGAGGTTGTGTATGG - Intronic
1012650133 6:101742311-101742333 CCTCCTGAAGATGTGGTTTAGGG + Intronic
1018989189 6:168660252-168660274 CCTTCCAAAGAGATTGTCTAGGG - Intronic
1025039605 7:55629681-55629703 CCCTCTGAAGTTGTTGTTTAAGG - Intergenic
1030159173 7:106489953-106489975 CCTGCTGAAGAGGCTGCGTGGGG - Intergenic
1030376285 7:108756374-108756396 CCTGCTGAAGACTTTGTGTGTGG - Intergenic
1031816685 7:126446703-126446725 CCTTCTAAAGAAGTTCTGTGTGG - Intronic
1032372188 7:131367861-131367883 CCTTCAGTAGAGGCTGTGGATGG + Intronic
1034417511 7:150972830-150972852 CCTTCTGGAGAGGATGGCTATGG - Intronic
1035334748 7:158120759-158120781 CCATCTGAACAGCTTGTGAAGGG + Intronic
1035353093 7:158260475-158260497 CCTTCTGAAGAAGTCGTATCCGG - Intronic
1036117007 8:5969822-5969844 CCTTCTAAAGAGGTGGCTTAAGG - Intergenic
1038664531 8:29526641-29526663 CCCTCTGCACAGCTTGTGTAAGG + Intergenic
1039231342 8:35452069-35452091 CATTCTGAAGTGGATATGTATGG - Intronic
1040342861 8:46450652-46450674 ACTTCTGTAGAAGTTGTGAAAGG - Intergenic
1040345569 8:46489417-46489439 CATTCTGATGAAGTTGTGAAAGG + Intergenic
1040794399 8:51273254-51273276 CCATCTGAAGAGCTTGTTCAAGG - Intergenic
1041549429 8:59082993-59083015 CCCACTGAAGAGGCTGTGTCTGG + Intronic
1044505300 8:93009663-93009685 CATTCTGAATAGCCTGTGTAAGG - Intronic
1048642703 8:136382109-136382131 CCCTCTGAAGATGTTCTGTGAGG - Intergenic
1048845594 8:138601577-138601599 TCTTCTGAAGAGCCTGTGGAAGG - Intronic
1052801607 9:32973245-32973267 CCTTCTGAAGATGGTGGGTCAGG + Exonic
1053066980 9:35075798-35075820 CCTGGTGAAGAGGTTGGGGATGG - Intronic
1053340822 9:37327942-37327964 ACATCTGAAGAGTTTTTGTACGG + Intronic
1059289800 9:113212599-113212621 ACTTCTGCAGGGGTTGTGGAAGG + Intronic
1059668396 9:116471296-116471318 GCTTGTGGAGAGGTTGTGTGTGG - Intronic
1060704649 9:125787149-125787171 GCTACTGAAGAGGTTGAGTTGGG - Intronic
1062160512 9:135077039-135077061 CCTCCTGGAGAGGTTCTGCATGG + Intronic
1062327864 9:136020937-136020959 CCTTCTGCAGTTTTTGTGTAGGG - Intronic
1186107495 X:6223253-6223275 CCTTGGGAAGATGTGGTGTATGG + Intronic
1186450055 X:9664718-9664740 ACTTCTGAAGATGTTGTGAATGG + Intronic
1189284011 X:39839186-39839208 CATGCTGGAGAGGTGGTGTATGG - Intergenic
1190961780 X:55257344-55257366 GCTTCTGAAAGTGTTGTGTAAGG - Intronic
1192944095 X:75946359-75946381 CCTTCTGATGGGGTTGTGTTTGG + Intergenic
1194514284 X:94830955-94830977 GCTTTTGAAGAGATTGAGTATGG - Intergenic
1196206890 X:112950277-112950299 GCTTCTAAATAGGTTGAGTATGG + Intergenic
1198463556 X:136884925-136884947 CCTTTTTAAGAGGTGGAGTAAGG + Intergenic