ID: 1132273349

View in Genome Browser
Species Human (GRCh38)
Location 15:100544984-100545006
Sequence CGTGTTTTCACCTTCTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273349_1132273352 -10 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273349_1132273355 6 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273355 15:100545013-100545035 CTACAGGCTGTTGATAGGAAGGG No data
1132273349_1132273356 7 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273356 15:100545014-100545036 TACAGGCTGTTGATAGGAAGGGG No data
1132273349_1132273357 19 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273357 15:100545026-100545048 ATAGGAAGGGGAAGCCCTTCTGG No data
1132273349_1132273353 1 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data
1132273349_1132273354 5 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273354 15:100545012-100545034 TCTACAGGCTGTTGATAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273349 Original CRISPR CGTGTTTTCACCTTCTGAAG AGG (reversed) Intronic
904401736 1:30261200-30261222 CATGTTTTCAACCTCTGAATAGG + Intergenic
905517890 1:38575635-38575657 CATGTTTTCACTTTCAGAATGGG + Intergenic
908085260 1:60625467-60625489 CGTTTTTTCATCTGCTGAGGAGG + Intergenic
912818745 1:112850268-112850290 CCTGTTTCCTCCCTCTGAAGTGG + Intergenic
912831435 1:112956797-112956819 CCTGTTTCCTCCCTCTGAAGTGG + Intronic
913240997 1:116829225-116829247 GGTGAGTTCACCTGCTGAAGAGG - Intergenic
914967270 1:152271176-152271198 CATCTGTTCAGCTTCTGAAGAGG + Intergenic
914969098 1:152290937-152290959 CATCTGTTCAGCTTCTGAAGAGG - Intergenic
919932693 1:202231590-202231612 CGTTTTCTCACCTTTTAAAGTGG + Intronic
923144014 1:231185347-231185369 CTTGTTTTCCTCATCTGAAGTGG + Intronic
923465723 1:234246585-234246607 GATGTTTTCCCCTTCTGAATAGG + Intronic
924857216 1:247885715-247885737 GGTGGTTTCACCTCCTCAAGAGG - Intergenic
1063907284 10:10794278-10794300 AGTCATTTCACCTTCTTAAGAGG + Intergenic
1079283952 11:19112502-19112524 GGTGTTATGACTTTCTGAAGAGG + Intergenic
1087426095 11:97988335-97988357 TGTTTTTTCACTTTCTGAATAGG - Intergenic
1091043645 11:132305883-132305905 TGTGTTTTCTACTTATGAAGAGG + Intronic
1093749806 12:22785020-22785042 CATGTTTTCCCCTTCTGTGGAGG + Intergenic
1095422119 12:42035292-42035314 AGTTTTTTCATCTTCTCAAGTGG - Intergenic
1096469000 12:51864601-51864623 CGTGCTGTCAGCTTCTGCAGCGG + Intergenic
1097366405 12:58718555-58718577 CATGGTTCCACCTTCTGTAGGGG + Intronic
1098448524 12:70592687-70592709 TATTTTTTCACCATCTGAAGAGG - Intronic
1098937583 12:76498421-76498443 CGTGCTTGCACCTTGTAAAGTGG - Intronic
1102656127 12:114483806-114483828 CACGTTTGCCCCTTCTGAAGAGG + Intergenic
1105308923 13:19189291-19189313 CCTGTTTCCACCTTATGAAGAGG - Intergenic
1105528676 13:21198860-21198882 CCTGTTTCCACCTTATGAAGAGG + Intergenic
1112825734 13:103390835-103390857 CATGATTTCACCTTCTGGAATGG + Intergenic
1116385828 14:44328718-44328740 CATGATTTCATATTCTGAAGGGG - Intergenic
1117028103 14:51642208-51642230 AGGGTTTTCAACATCTGAAGTGG + Intronic
1117312152 14:54538109-54538131 TGTGTTTTTTTCTTCTGAAGAGG - Exonic
1117992091 14:61443953-61443975 TGTGTTTTCTCCTTCTGAGATGG - Intronic
1125765728 15:42134343-42134365 CGTGTTTTCATTTCCTGAATAGG - Intergenic
1126273959 15:46854502-46854524 CGTGCTTTCCTCTTCTGAAATGG - Intergenic
1127318979 15:57824324-57824346 AGAGTTTCCACCATCTGAAGAGG + Intergenic
1130106378 15:80931753-80931775 CATGTTTGCCCCTTCTGAGGTGG - Intronic
1132273349 15:100544984-100545006 CGTGTTTTCACCTTCTGAAGAGG - Intronic
1134156915 16:11851513-11851535 CTTGTTTCCACCTCGTGAAGAGG + Exonic
1141047180 16:80725917-80725939 GAAGTTTTCATCTTCTGAAGTGG + Intronic
1152510753 17:80785930-80785952 CGTGTGTTCACCTTCTAACCGGG + Intronic
1153087751 18:1307885-1307907 CATGTATTCAGCTTCTGGAGAGG + Intergenic
1155508894 18:26557758-26557780 TGTGTGTGCATCTTCTGAAGAGG - Intronic
1155823185 18:30404331-30404353 TTTGTTTTCTCCTTCTGATGTGG + Intergenic
1156693749 18:39740711-39740733 GGTGTTTTCATCTTCAAAAGGGG + Intergenic
1156716179 18:40013732-40013754 CGTGTCTTCACCTTCTTGAAAGG - Intergenic
1156752425 18:40475165-40475187 CCTGTCTTCACATTCTGATGCGG + Intergenic
1156865594 18:41885749-41885771 TGTGTTTTTACCTTCTTAAGCGG + Intergenic
1158659963 18:59378062-59378084 TGTGTTTTCAGCATCTGATGAGG + Intergenic
1161296932 19:3524830-3524852 CGTGTTTTCCTCTTCTTATGAGG + Intronic
1166282736 19:41805878-41805900 TGTGTTTTCTCCTCCTGCAGAGG - Intronic
927431034 2:23026247-23026269 TGGGTTTTCCCCATCTGAAGCGG - Intergenic
930250728 2:49031228-49031250 CATGTTAGCAGCTTCTGAAGGGG + Intronic
930540058 2:52694286-52694308 CATGTTTTCACCCTCTGAAAAGG - Intergenic
931178351 2:59875579-59875601 TGTTTTTTCTCCTCCTGAAGAGG - Intergenic
931456250 2:62411778-62411800 CGTGTTTACAGTTTCTCAAGTGG + Intergenic
934536413 2:95137985-95138007 CCTGTTTTCACCATGTGATGTGG + Intronic
936462068 2:112721466-112721488 AGGGTTGTCACCTTCTGAAATGG - Exonic
937326838 2:120994555-120994577 CGTCCTTTCAACTTCTGATGAGG + Intergenic
940004935 2:149001727-149001749 CGTGTTTTCACCAAATGGAGAGG - Intronic
940376400 2:152963748-152963770 CTTGTTTTCACTTTCCCAAGTGG + Intergenic
941313767 2:163967371-163967393 TTTATTTTCACCTACTGAAGGGG - Intergenic
942019503 2:171852167-171852189 TGAGTTTTCACGTTCTGAAATGG + Intronic
942245544 2:174004511-174004533 GGTGTGTTCACCTTCTGACTGGG + Intergenic
944134986 2:196389430-196389452 CATGTTTTGAACTTCTAAAGGGG - Intronic
944196607 2:197061486-197061508 CCTGTTTTTACTTTCTGTAGTGG - Intronic
1169253249 20:4076660-4076682 TGTGTTTTTATCTTCTTAAGAGG + Intergenic
1169953963 20:11080956-11080978 AGTATTTTCATCCTCTGAAGAGG + Intergenic
1173219662 20:41121623-41121645 CTTGGTTTCACCTTCTCAGGTGG + Intronic
1175863489 20:62162681-62162703 GGTGTCTTCACCTTCAGAAGTGG + Intronic
1177673624 21:24267755-24267777 TATGTATTCACCTCCTGAAGGGG + Intergenic
1178342178 21:31794954-31794976 TGTGTTTTCAGCTTCTGTAGTGG + Intergenic
1178625694 21:34216531-34216553 CGTGTTTTCAGCAGCTGTAGTGG + Intergenic
1179329968 21:40390465-40390487 CTTGGCTTCACCTTCTGATGTGG + Intronic
1182252554 22:29012711-29012733 AGTGATTTCAACTTCTGAAGGGG + Intronic
955002098 3:54937107-54937129 GGTGTCTTCACCTTCAGAAGTGG - Intronic
956286098 3:67612189-67612211 AATGTTTTCACTTTCTGTAGAGG - Intronic
961372598 3:126440664-126440686 TTTGTTTCCAGCTTCTGAAGAGG - Intronic
961639212 3:128354368-128354390 CTTTTTTTGACCTTCTGAGGAGG - Intronic
961694220 3:128693053-128693075 CGTGCTTGCAGCATCTGAAGTGG - Intergenic
963536035 3:146529477-146529499 CGTGCTTTCACCTTCAACAGTGG - Intronic
965611366 3:170547209-170547231 GTAGTTTCCACCTTCTGAAGTGG + Intronic
965722285 3:171675119-171675141 CCTGTTTTTACCTTTTGTAGGGG + Intronic
966203255 3:177378909-177378931 TGTGTTTTGTGCTTCTGAAGGGG + Intergenic
969314886 4:6375994-6376016 CATGATTTCACCTTCTAAAGTGG - Intronic
971630712 4:28989362-28989384 CGTGTTTTCTGCTTCTAAAATGG + Intergenic
972532702 4:39976082-39976104 ACTATTTTCAGCTTCTGAAGGGG - Intronic
972880582 4:43417519-43417541 GGGGTTTGCACCTTCTGATGTGG + Intergenic
979127878 4:116999033-116999055 CTTGTTTTCACCTTCAGACTTGG - Intergenic
984332545 4:178343836-178343858 TGTAATTTCAGCTTCTGAAGAGG + Intergenic
984565417 4:181324198-181324220 CTTGTGTTGACCTTCTGAAAAGG + Intergenic
985353542 4:189093101-189093123 CGTTTTGTCACCTTCCAAAGCGG - Intergenic
986112039 5:4729017-4729039 CGAGTTTTCTGCTTCTGAACTGG + Intergenic
986138751 5:5009253-5009275 GGAGTTTTAACCTGCTGAAGTGG - Intergenic
986360867 5:6976504-6976526 CATCTTTTCAGCTTCTGGAGAGG - Intergenic
988501660 5:31788838-31788860 TGTGCTTTCACCTTTTTAAGGGG + Intronic
989190779 5:38667651-38667673 TGTGTTTTCATCTGCTCAAGAGG + Intergenic
989315316 5:40071459-40071481 ATTGTTTACACCTTCTGGAGTGG - Intergenic
990716327 5:58641321-58641343 CTTGTTTTCTCCTTCGTAAGTGG - Intronic
990826688 5:59907963-59907985 AATGCTTTCACCTTCTGAAAGGG - Intronic
991752180 5:69818636-69818658 CTTGTTTTAACATTATGAAGGGG - Intergenic
996004806 5:118406853-118406875 CATGTGTTCAGCTTCTGAGGAGG + Intergenic
998622816 5:143812979-143813001 CTTGTTTTCTCCTCTTGAAGAGG + Intronic
1000843593 5:166252048-166252070 CGAGTTTTCATCTTCAGAGGGGG + Intergenic
1004202685 6:13564260-13564282 TGCATTTTCACCTTCTGGAGTGG - Intergenic
1004391969 6:15217502-15217524 AGTGTTTTTACTTTCTGAAAGGG - Intergenic
1004792093 6:19037858-19037880 GGTGATTTCACCTTCTAAAATGG + Intergenic
1007815664 6:44523350-44523372 CTTTTTTTCTCTTTCTGAAGAGG + Intergenic
1017172458 6:151470756-151470778 CATATTTTCAGCTACTGAAGAGG - Intergenic
1017532760 6:155313414-155313436 GCTCTTTTCAACTTCTGAAGTGG + Intronic
1023578740 7:41658435-41658457 TGTGTTTTCTCCATCTGCAGAGG + Intergenic
1024845159 7:53633967-53633989 CCTATTTTCCCCTTCTGAAAGGG + Intergenic
1027376308 7:77554266-77554288 GGTGTTTTCACTTTTTTAAGTGG + Intronic
1028198574 7:87934761-87934783 CTGTTTTTCTCCTTCTGAAGAGG + Intronic
1029695979 7:102213524-102213546 CCTGGTTTCCCCTTCTGAAAAGG + Intronic
1036017130 8:4797401-4797423 GCTGTTTTCAGCTTTTGAAGTGG - Intronic
1039177427 8:34825471-34825493 CGTACTTTCACCTTCTGATGTGG + Intergenic
1047258522 8:123235367-123235389 TGTCTTTTCACATTCTGTAGGGG - Intronic
1051291832 9:15553074-15553096 AGTGTTTTCAGCTCCGGAAGTGG + Exonic
1056251549 9:84753541-84753563 CATCTTGTCACATTCTGAAGGGG - Intronic
1058130517 9:101247466-101247488 AGTGTTTTCAGTTTCTGATGGGG + Intronic
1061701953 9:132422785-132422807 CCTGTTGTCACCTTCAGTAGAGG - Intronic
1061763913 9:132869561-132869583 GGTGTTTTCAGCTTCTGGGGTGG + Intronic
1061864244 9:133484434-133484456 CCTGTTTTAACCTTCTCATGGGG + Intergenic
1185981683 X:4786455-4786477 CATGTTTTCCTCTTCCGAAGGGG + Intergenic
1187037871 X:15561128-15561150 TGTATGTTCACCCTCTGAAGTGG - Exonic
1189075337 X:37908453-37908475 CGTTTTTTCAGCTTCTATAGTGG + Intronic
1196086203 X:111684623-111684645 CCTGTTTTCAACTTATGATGGGG + Intronic
1199935119 X:152565819-152565841 CTTGTTTTTGCCTTCTGAAGAGG - Intergenic
1201725475 Y:17145727-17145749 CTTGTTTTCACTTTTTGAAGTGG + Intergenic