ID: 1132273350

View in Genome Browser
Species Human (GRCh38)
Location 15:100544988-100545010
Sequence TTCAGAAGGTGAAAACACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273341_1132273350 21 Left 1132273341 15:100544944-100544966 CCTGGGCCTTCCGTGATTCCGAA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273347_1132273350 -9 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273342_1132273350 15 Left 1132273342 15:100544950-100544972 CCTTCCGTGATTCCGAACCCAGC 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273345_1132273350 -2 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273346_1132273350 -3 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273344_1132273350 3 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1132273343_1132273350 11 Left 1132273343 15:100544954-100544976 CCGTGATTCCGAACCCAGCGCCT 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273350 Original CRISPR TTCAGAAGGTGAAAACACGA AGG Intronic
901076849 1:6560531-6560553 TGCAGATGGTGAAAAAAAGAGGG + Intronic
902235048 1:15051803-15051825 ATAAGATGGTGAAAACAAGAGGG - Intronic
907075831 1:51577129-51577151 GTCACATGGTGAAAACAGGAAGG - Intergenic
907577138 1:55536797-55536819 TTCAGAAGATGCAAACCTGAAGG - Intergenic
907665798 1:56432962-56432984 TTTGGAAGGTGAAATCAAGAAGG - Intergenic
910178590 1:84457571-84457593 TTCAGAAAGTGAAATCACTTTGG + Intergenic
912254059 1:108041190-108041212 TTCTGAAGGTGAAAGCAACAAGG + Intergenic
915034386 1:152910120-152910142 TTAAGCAGGAGAAAACACAAAGG + Exonic
917107385 1:171506507-171506529 TTGAGAAAGTGAAAAAACAATGG - Intronic
918381337 1:183958754-183958776 ATTATAAGGTGAAAACAAGAGGG - Intronic
918779328 1:188676475-188676497 TTCAGAAGGAGAAAATGCCAGGG + Intergenic
919066033 1:192693687-192693709 TTCAGAGGGTGAAAGCCCCAAGG - Intergenic
919128324 1:193424049-193424071 TTCAGAATGTGAAAAAATTATGG - Intergenic
919799278 1:201343420-201343442 TAAGGAAGGAGAAAACACGAGGG + Intergenic
920049535 1:203154974-203154996 ATCAGATGGTGAACACACCATGG - Intronic
920640897 1:207751516-207751538 TTGAGATTGTGAAAACAAGACGG + Intergenic
920778993 1:208969658-208969680 TTCAGAGAGTGGAAACACCAAGG - Intergenic
921909396 1:220529747-220529769 TTCAGAAGGTGGAAATACAAGGG - Intronic
922690109 1:227682247-227682269 TTCATACAGTGAAAACAGGATGG + Intergenic
1066208143 10:33209788-33209810 TTTAATAGGTGAAAACACCACGG + Intronic
1067857183 10:49804657-49804679 TTCAGTAGGTGAATGCACTATGG - Intergenic
1075907234 10:126092278-126092300 TTGAGAGTGAGAAAACACGAAGG + Intronic
1076711584 10:132338649-132338671 TTCAGAAGGTGAAAAAGCCATGG - Intronic
1080729856 11:34938267-34938289 TTCAGAAGAAGAAAAAAAGAGGG + Intronic
1081578604 11:44335372-44335394 TTCAGAAAGTGTACACACGAAGG + Intergenic
1082847745 11:57740215-57740237 GTCAGATGGGGAAAACAAGAAGG + Exonic
1083182905 11:60999471-60999493 TTCAGAAGCTTAAAACATGGCGG + Intronic
1083923558 11:65793017-65793039 TTCAGAAGGAAAAATCACGAGGG - Intronic
1086895315 11:92305178-92305200 TTGAGAATGTGAAAACTCCAAGG - Intergenic
1087391838 11:97545290-97545312 TTAAGAAGGTGAAAGCACAGGGG + Intergenic
1090135673 11:124196688-124196710 TTCAGAAGTTTAAAACACATTGG + Intergenic
1093347625 12:18058186-18058208 TTCTGAAGCTGAAAATACAATGG + Intergenic
1093484986 12:19642635-19642657 GTGAGAAGGTGAATACACTAGGG - Intronic
1095638875 12:44464209-44464231 ATCAAAATGTAAAAACACGAAGG + Intergenic
1095836813 12:46648238-46648260 TTCAGAGGGTGCAAACCCCAAGG - Intergenic
1096576044 12:52553483-52553505 TGCAGCAGGTGAAGACAGGATGG + Intergenic
1097380105 12:58884711-58884733 GTCAGAAGGTGACAACACAGTGG + Intronic
1098661026 12:73094153-73094175 TTCAGAAGGTGCAGACACCAAGG + Intergenic
1100373821 12:93993952-93993974 TTCAGAAGGTGGGAACAGCATGG + Intergenic
1103108288 12:118250881-118250903 TTAAGAAGGTGAAAATAGAAGGG + Intronic
1105449934 13:20490492-20490514 TTGAGAAGATGAAAACATGCTGG + Intronic
1105868086 13:24479239-24479261 TTCAGTAGGTGAAACAAAGAAGG - Intronic
1107694234 13:42984993-42985015 TTCAGAAGCTGACACCAAGATGG + Intronic
1107814181 13:44229426-44229448 TTCTGAATGAGAAAACACGTTGG - Intergenic
1108691938 13:52867040-52867062 TCCAGTAGGTGAAGACATGAAGG - Intergenic
1110578295 13:77086540-77086562 TTCAGAAGGAGAAGACAGAATGG - Intronic
1114901773 14:27070103-27070125 TACAGAAGCTGAAAACACAATGG + Intergenic
1116253254 14:42515605-42515627 TTCAGAGGGTAAAAACAAAAGGG + Intergenic
1116377960 14:44227921-44227943 TTCAGAAGGTACATAGACGAAGG + Intergenic
1118119549 14:62823583-62823605 TTCAAAAAGTGAAGACAGGAGGG - Intronic
1118508203 14:66440028-66440050 CCCAGAAGGAGAAAACAAGAAGG - Intergenic
1119679607 14:76582482-76582504 TTCAGAAAATGAAATCACAATGG + Intergenic
1121822772 14:96984752-96984774 TTCATAAGGTGAAAACTCATTGG + Intergenic
1122590192 14:102843897-102843919 TGAAAAAGGTGAAAACACTATGG + Intronic
1202878710 14_KI270722v1_random:36245-36267 TTAAGAAGAGGAAAAAACGAAGG + Intergenic
1124916740 15:33982754-33982776 TTCATAAGGGGAAAACATCATGG - Intronic
1128614959 15:69101779-69101801 TTGAGAAAGTGAAAAGAAGAGGG - Intergenic
1129132692 15:73514809-73514831 TTTAAAAGGAGAAAACAGGAAGG + Intronic
1129786290 15:78312347-78312369 ATCAGAAGGTCAAAACTGGAAGG - Intergenic
1129852416 15:78801108-78801130 TTCCCTTGGTGAAAACACGAGGG - Intronic
1132273350 15:100544988-100545010 TTCAGAAGGTGAAAACACGAAGG + Intronic
1132386013 15:101400364-101400386 TTCAGAAGGTGAACCCCAGAAGG - Intronic
1132789182 16:1675541-1675563 TGGAGAAGGTGAAAAGAGGAGGG + Exonic
1134156914 16:11851509-11851531 TTCACGAGGTGGAAACAAGATGG - Exonic
1143862491 17:9901037-9901059 TCCAGACGATGAAAACACGCCGG - Exonic
1144487407 17:15678508-15678530 GTCAGAAGGGGAAAACAGCATGG - Intronic
1144913626 17:18703807-18703829 GTCAGAAGGGGAAAACAGCATGG + Intronic
1145738065 17:27247467-27247489 TTCAGAGGGTGACAACATAAGGG - Intergenic
1148389894 17:47263896-47263918 TTCACAAGGGAAAAACAGGAAGG - Intronic
1150613031 17:66748983-66749005 TTCAGAGGGTGACACCAGGACGG + Intronic
1150613068 17:66749143-66749165 TTCAGAGGGTGACACCAGGACGG + Intronic
1152667102 17:81577454-81577476 TTCAGAGGGAGAAAAGAAGAGGG - Intronic
1155461616 18:26090486-26090508 TTCAGAAGGTGAAACCGCGCGGG - Exonic
1156532651 18:37832913-37832935 TTCAGAGGGTGGAACCAAGATGG - Intergenic
1156865592 18:41885745-41885767 TTAAGAAGGTAAAAACACATGGG - Intergenic
1202654332 1_KI270708v1_random:5279-5301 TTAAGAAGAGGAAAAAACGAAGG + Intergenic
925090897 2:1155503-1155525 TTCAGAAGGTTAATACAGAAAGG + Intronic
925478561 2:4245739-4245761 TTCAGAAGGTGATAACAAAGGGG - Intergenic
926510961 2:13777238-13777260 TGCACAAGGAGAAAACACCAAGG - Intergenic
926945976 2:18187817-18187839 TTCTGTAGGTGAAAAAAAGATGG - Intronic
928424609 2:31167783-31167805 TTCAGAAGATGAGCACACTAAGG + Intergenic
929505469 2:42524748-42524770 CTCAGAACCTGAAAACACTAGGG + Intronic
931219887 2:60279435-60279457 CTCAGAAGGTGAAAAAACTGGGG + Intergenic
936619641 2:114082187-114082209 TCCAGAAGGTGAAAAGGAGAAGG - Intergenic
936630444 2:114196720-114196742 TTCAGAAGCTGGAAACATGAAGG + Intergenic
937270343 2:120646580-120646602 TTCAAAAGATGAAATCACGCAGG - Intergenic
937326837 2:120994551-120994573 ATCAGAAGTTGAAAGGACGATGG - Intergenic
939781826 2:146458939-146458961 TTCAGAGGGTGAAAGCCCCAGGG - Intergenic
941010321 2:160292454-160292476 TTCAGAAGGTCTAAACACTTGGG + Intronic
941649806 2:168080878-168080900 TTCAGAGGGTGCAAACCCCAAGG + Intronic
941706485 2:168664052-168664074 TTCAGAAGGGCGAAACACAATGG - Intronic
943040617 2:182800334-182800356 TTCAGAAGATAAAAACAAGCTGG - Intergenic
946197322 2:218042531-218042553 TTCAGAAGATGAAATGAGGATGG + Intronic
948325527 2:237116960-237116982 TTCAGAAGGCAAAATCAAGAAGG + Intergenic
1169430473 20:5531764-5531786 TTCAGAAAGTGAAATCTCCAAGG + Intergenic
1169867696 20:10218666-10218688 TATAGAAGGTGAAAACACGCAGG + Intergenic
1171021465 20:21588073-21588095 TTCAGAAGGTGCCATGACGATGG + Intergenic
1171088839 20:22265115-22265137 TTCAGAATGTGAAATCGCCATGG - Intergenic
1171160848 20:22921605-22921627 TTATGAAGGTGATAACACTAGGG + Intergenic
1173268348 20:41508079-41508101 TTCAGAAAGTGAAAACAGCATGG + Intronic
1174127394 20:48317045-48317067 TTCAGAAGCTGAAGCCACGGAGG + Intergenic
1177311252 21:19396577-19396599 TTAAAAAGGTGAAAACACTTTGG - Intergenic
1178004105 21:28196977-28196999 TTCAGAAGGTGGAAGCCCCAAGG - Intergenic
1178195708 21:30343167-30343189 CTCAGATGGTCAAAACACCATGG - Intergenic
1178625692 21:34216527-34216549 TACAGCTGCTGAAAACACGAGGG - Intergenic
1180389163 22:12209146-12209168 TTAAGAAGAGGAAAAAACGAAGG - Intergenic
1180416778 22:12725326-12725348 TTAAGAAGAGGAAAAAACGAAGG + Intergenic
1181388271 22:22559830-22559852 TTTCGAAGGTGAAAACACAACGG - Intronic
1182018427 22:27060639-27060661 TACAGAATGTGTAAACAGGAAGG + Intergenic
1184678402 22:46055712-46055734 TTCAGAAAGTGAAAATAAGCGGG + Intronic
951032007 3:17893077-17893099 TTCACTAGGGGAAAACAGGAAGG - Intronic
951079634 3:18437782-18437804 TTCAGTTGGTGAAAATACAATGG + Intronic
951475843 3:23105223-23105245 TTCACAAGGTGAAAAAGCAATGG - Intergenic
952277669 3:31892887-31892909 TTCAGGAGGTGAGAAAACCATGG + Intronic
953122964 3:40063979-40064001 TACAGCAGGTGAGAACAGGAGGG + Intronic
959027361 3:101255543-101255565 AGCAGAAGGTGCAAACACCAAGG - Intronic
959921421 3:111872423-111872445 TTGACAAGGTGACAACAGGAGGG - Intronic
960384779 3:117009682-117009704 TTCAGAAGGTGAAAATAAACTGG + Intronic
961423353 3:126825747-126825769 GTGAGAAGGTGAAAAAAGGATGG - Intronic
963527244 3:146430124-146430146 TTCAGAAGATGAATAAAAGAGGG + Intronic
964554238 3:157918227-157918249 TTCAGAAGGTTACAACAAGGTGG - Intergenic
965498411 3:169427652-169427674 TACAGAAGATGGAATCACGAGGG + Intronic
965797323 3:172453991-172454013 TTCAAAAGTTGACAACACTATGG - Intergenic
966358924 3:179112948-179112970 TTTGGAAGGTGGAAACAAGATGG + Intergenic
966645582 3:182243336-182243358 TCCAGAAGGAGAAAAAAAGATGG + Intergenic
967733137 3:192924823-192924845 TTCAGAGGGTGGAACCAGGAGGG + Intergenic
971131764 4:23819191-23819213 TGCAGAAGGAGAGAACACTAGGG - Intronic
972029723 4:34439381-34439403 TACAGAAGATGAAGACAAGAAGG - Intergenic
978528019 4:109685753-109685775 TTCAGAAGGGAAAAAGATGAAGG - Intronic
978579548 4:110218365-110218387 TTCAGAGGGTGGAAGCACCAAGG - Intergenic
982213473 4:153060000-153060022 TTTGGAAGGTGAAAAAAAGAAGG + Intergenic
982464433 4:155712985-155713007 TTCAGCAGGTTTAAACACAAAGG + Intronic
982998492 4:162381764-162381786 TTCAGAAGATAAAAAGAAGATGG + Intergenic
984565415 4:181324194-181324216 TTCAGAAGGTCAACACAAGGTGG - Intergenic
987214484 5:15719164-15719186 TTCATAAGGAAAAAAAACGAGGG - Intronic
988052590 5:26050341-26050363 TTAAGAGGGTGATAACACTAGGG + Intergenic
994421425 5:99529697-99529719 TACAAAAGCTGAAAACAAGAAGG - Intergenic
994530198 5:100958974-100958996 TTCAGTAGAGGAAAACAGGAAGG + Intergenic
997998175 5:138603276-138603298 TTCAGAAGATAAAAACATGAAGG + Intergenic
998800611 5:145865104-145865126 TTCAGATGATGAGAACAAGAAGG - Intronic
999634164 5:153602791-153602813 TTCAGAAAATGAAAACACTTTGG - Intronic
999692622 5:154161734-154161756 TTCAGAAGGTGGAAGCAGCAAGG - Intronic
1001117432 5:168951497-168951519 TTCAAATGGTCAAAGCACGAAGG + Intronic
1003195226 6:3908557-3908579 TTCAGAAAGTGAACACGTGAGGG - Intergenic
1007137102 6:39533001-39533023 TTCAAAAGCTGGAAACAGGAGGG + Intronic
1012050140 6:94330988-94331010 TTCAGTAGAGGAAAACAGGAAGG + Intergenic
1012259633 6:97072688-97072710 TTCAGAAGGTGACAAAGTGAGGG - Intronic
1016403654 6:143707229-143707251 TTAAGAAAGTTAAAACACTAAGG - Intronic
1017716391 6:157216720-157216742 TTCAGAATGAAAAAGCACGATGG - Intergenic
1019132948 6:169890697-169890719 TTCAGAAGGTGAATTCTGGACGG - Intergenic
1022119783 7:27297079-27297101 TTCAGAATGTGCAAACACTCAGG - Intergenic
1025706390 7:63868811-63868833 ATCAGAAAGTGAAAACACATGGG - Intergenic
1026082365 7:67233133-67233155 TTCAGAAGCTGAACAGATGATGG - Intronic
1026694708 7:72580861-72580883 TTCAGAAGCTGAACAGATGATGG + Intronic
1032083274 7:128870416-128870438 GTCAGAAGGTGAAGACACACGGG - Intronic
1034074640 7:148220021-148220043 TTCAGAAGGGGAAAATACTAGGG - Intronic
1034914129 7:155023025-155023047 TCCAGAAGGTGAAAAGAGAATGG - Intergenic
1039340028 8:36637625-36637647 TTCAAGATGTGAAAACAAGAAGG - Intergenic
1039547820 8:38422285-38422307 GCCAGAAGGTGAACACAGGAGGG + Intronic
1039681481 8:39742403-39742425 TTCAAAATGTGCAAACACCATGG - Intergenic
1044631366 8:94281666-94281688 TTCAGAAAGAGAAAATACAAGGG + Intergenic
1046389352 8:113548333-113548355 TTATGAAGGTGAAAAAAAGAAGG + Intergenic
1048278108 8:133082648-133082670 TTTAGGAGGTGAAAATACCAGGG - Intronic
1053465825 9:38307567-38307589 TTCAGGAGGTGAACACCAGAAGG + Intergenic
1058721429 9:107768216-107768238 TGCAGTAGGTGAAAACTCCAGGG + Intergenic
1060254277 9:122013549-122013571 TTCAGAAGGAGCCAACAGGAAGG + Intronic
1194034506 X:88854233-88854255 TTCAGAGGGTGAAATCCCCAAGG + Intergenic
1194866273 X:99072168-99072190 ATCAGAAGGTGAAACTATGAAGG - Intergenic
1197349801 X:125369969-125369991 TTCAGAGGGTGCAAACCCCAAGG - Intergenic
1199938328 X:152599583-152599605 TTCACAAGGTGAAACCACCAGGG + Intergenic
1201169742 Y:11246378-11246400 TTAAGAAGAGGAAAAAACGAAGG - Intergenic