ID: 1132273351

View in Genome Browser
Species Human (GRCh38)
Location 15:100544989-100545011
Sequence TCAGAAGGTGAAAACACGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273345_1132273351 -1 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273343_1132273351 12 Left 1132273343 15:100544954-100544976 CCGTGATTCCGAACCCAGCGCCT 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273346_1132273351 -2 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273341_1132273351 22 Left 1132273341 15:100544944-100544966 CCTGGGCCTTCCGTGATTCCGAA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273344_1132273351 4 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273342_1132273351 16 Left 1132273342 15:100544950-100544972 CCTTCCGTGATTCCGAACCCAGC 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179
1132273347_1132273351 -8 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273351 Original CRISPR TCAGAAGGTGAAAACACGAA GGG Intronic
904682066 1:32236067-32236089 TCAGAAAGTGAAACCATGGATGG - Intergenic
905417304 1:37812786-37812808 TCAGAAGTTGTAAACAGCAAGGG + Exonic
906883854 1:49622863-49622885 TCATAAGATGAAAAGAGGAATGG - Intronic
907665797 1:56432961-56432983 TTGGAAGGTGAAATCAAGAAGGG - Intergenic
908744400 1:67361701-67361723 TGAGAAGGTAAAAAAAAGAAAGG + Intronic
909275418 1:73679047-73679069 AAAGAAGGTGAAAACACTAGAGG + Intergenic
909876569 1:80812491-80812513 ACAGAAGGTGAAAACCAGGAGGG + Intergenic
910794125 1:91080979-91081001 TCAGAGGGTGGCAACATGAAAGG - Intergenic
912341559 1:108920854-108920876 TCTGAATGTGAAAACACATATGG - Intronic
913422457 1:118687211-118687233 CCAGAAGGAGAAAAAAAGAAGGG + Intergenic
913435451 1:118842750-118842772 CCAGAAGGTGAAAAGAAGTAGGG + Intergenic
914903502 1:151725521-151725543 TCAGAGGGTGAAAATACACATGG + Intronic
915034387 1:152910121-152910143 TAAGCAGGAGAAAACACAAAGGG + Exonic
920049534 1:203154973-203154995 TCAGATGGTGAACACACCATGGG - Intronic
920814292 1:209316411-209316433 TCACAAGGGGAAGACAAGAAAGG + Intergenic
922210232 1:223480775-223480797 TCAAAAGGTGAAAAGACACAGGG - Intergenic
923243314 1:232106917-232106939 TAAGAAGGTCAAAATACAAAAGG + Intergenic
1065898293 10:30183416-30183438 TCAGGAGGAGAAAATACCAAGGG - Intergenic
1065926471 10:30437917-30437939 TCTGAAGGAGAAAAGACAAAAGG - Intronic
1071056306 10:81512794-81512816 TCAGAAGGTGAAAACACAACTGG - Intergenic
1072790887 10:98317028-98317050 TCAGAAGGTGAAACCAAACAAGG - Intergenic
1074993960 10:118739413-118739435 TCTCAAGGGGAAAAAACGAATGG + Intronic
1078586133 11:12591042-12591064 TCAGATGGTGTTAACACTAATGG - Intergenic
1080259084 11:30325965-30325987 TCAGAATGTGAAAACCTGAAAGG + Intronic
1083923557 11:65793016-65793038 TCAGAAGGAAAAATCACGAGGGG - Intronic
1084460707 11:69295092-69295114 TCATGAGGTGAAAACGTGAAGGG + Intronic
1085355352 11:75831647-75831669 TAAGAAGGTGTAAAAAGGAATGG + Intronic
1087102317 11:94377640-94377662 ACTGAAGGTGAAAACCAGAATGG - Exonic
1087389259 11:97513580-97513602 TCAGATTGTAAAAACAGGAAAGG - Intergenic
1088357807 11:108961496-108961518 TTAGAAGGGGAAAAAATGAAAGG - Intergenic
1090145524 11:124317891-124317913 TCAGAAGGTGATGAAATGAATGG + Intergenic
1090513056 11:127395904-127395926 TAAGAAGGTGAGAAGAAGAATGG - Intergenic
1093484985 12:19642634-19642656 TGAGAAGGTGAATACACTAGGGG - Intronic
1096870117 12:54587868-54587890 TCCGAAAGTGATAACAGGAAGGG - Intronic
1098535507 12:71590011-71590033 TCAGGAGCTGAAAAAATGAAGGG - Intergenic
1099073476 12:78076070-78076092 TCAGATTGGGAAAACAAGAAGGG - Intronic
1099884706 12:88513359-88513381 ACAGAAGGTCAATACACAAATGG + Intronic
1103313940 12:120036283-120036305 TCAGAAGGTGTAACCATGGAAGG + Intronic
1105429736 13:20325977-20325999 TCAGCAGTTGAAGACACAAAAGG + Intergenic
1105868085 13:24479238-24479260 TCAGTAGGTGAAACAAAGAAGGG - Intronic
1106491199 13:30223713-30223735 GCAGAAACTGAAAAAACGAAAGG + Intronic
1109714803 13:66207365-66207387 AAAGAAGGTGAAAACACACAAGG - Intergenic
1110560368 13:76905152-76905174 TCAGAAGGTGGAAACTGGCATGG - Intergenic
1113275305 13:108722003-108722025 TCAGAGGGTGAAATCAAGCATGG - Intronic
1114572814 14:23685953-23685975 ATAGAAGGTGAGGACACGAATGG + Intergenic
1115317498 14:32040423-32040445 ACAGAAGGTGAAAAAGAGAAGGG + Intergenic
1116377961 14:44227922-44227944 TCAGAAGGTACATAGACGAAGGG + Intergenic
1116951826 14:50885560-50885582 TTAGAAGATGAAAACAGAAAAGG - Intronic
1120579434 14:86227781-86227803 GAAGAAGGTGAAAACACAAATGG - Intergenic
1120979966 14:90280644-90280666 TCAGAAGATGAAATCATGGACGG - Intronic
1121967690 14:98325702-98325724 GCAGCAGGTGAAAACACGGAAGG + Intergenic
1124362636 15:29049317-29049339 TCAGAAAGTGTAAACACACAAGG - Intronic
1125070817 15:35550650-35550672 CCAAAAGGTGAAATCACAAATGG - Intergenic
1125360275 15:38857511-38857533 CCTGAAGGTGAAAACAAGAAAGG + Intergenic
1132273351 15:100544989-100545011 TCAGAAGGTGAAAACACGAAGGG + Intronic
1132284302 15:100649879-100649901 TCAGAAGTTTACAAGACGAAGGG + Exonic
1136287732 16:29254156-29254178 TAAGACGGTGAAACCACTAAAGG - Intergenic
1138622384 16:58222513-58222535 TCAGAAGCAGAAGACACAAACGG - Intergenic
1139296953 16:65909520-65909542 TCAGGAGCTGAAAACACGTGAGG + Intergenic
1141484894 16:84332256-84332278 TCAAAAGGTGAAAAAAAAAATGG - Intergenic
1142093356 16:88226784-88226806 TAAGACGGTGAAACCACTAAAGG - Intergenic
1144602760 17:16633002-16633024 TCAGAAGAAGAAAACAGTAAGGG - Intronic
1145124910 17:20292224-20292246 TGGGAAGGTGAAAACAAGGAGGG - Intronic
1146631413 17:34472853-34472875 TCAGTAGCTGAAAACAGCAAAGG - Intergenic
1150318797 17:64192433-64192455 CCAGAAGCTGCAAACACGCAAGG + Intronic
1152197879 17:78928261-78928283 ACAGCAGGTGGAAACACGCAAGG + Intergenic
1152610677 17:81313783-81313805 TAAGAAGGCGAAGACATGAAGGG - Exonic
1153855437 18:9140320-9140342 GCAGAAGATGAAAACAATAAAGG - Intronic
1155461615 18:26090485-26090507 TCAGAAGGTGAAACCGCGCGGGG - Exonic
1158719943 18:59915798-59915820 TAAGAAGATGACAAAACGAATGG - Intergenic
1159497614 18:69225911-69225933 TCATAAGGTTAAAAAACCAAAGG - Intergenic
1159658560 18:71062851-71062873 TCAGAATGTGAAAACAACATAGG - Intergenic
1162461540 19:10816851-10816873 TCAGATGAGAAAAACACGAAGGG - Intronic
1163381429 19:16971471-16971493 TCAGATGGTCCAAACACAAAAGG + Intronic
1164103560 19:22081737-22081759 TCAGAAGGTCAAAACCAGAGTGG - Intronic
1166247806 19:41542681-41542703 ACAGAAGGTGGAATCACTAAGGG - Intergenic
1167193994 19:48014141-48014163 GCAGAAGGAGAAAACAGGAGTGG - Intronic
1168458471 19:56534183-56534205 TGAGAGGGGGAAAACACCAAAGG - Intergenic
927609250 2:24521391-24521413 TCAGAGGCTGAAGACAGGAAGGG - Intronic
929421157 2:41791009-41791031 TTAGAAGGTGAAATCATGTACGG + Intergenic
931219888 2:60279436-60279458 TCAGAAGGTGAAAAAACTGGGGG + Intergenic
931416978 2:62090783-62090805 TCAGATTGTGAAAACAGAAAAGG - Intronic
931464567 2:62475168-62475190 TCAGAAGCTGAAAACACCCCAGG - Intergenic
933476467 2:82798190-82798212 TGAGAAGGAGAGAACAGGAAAGG + Intergenic
934964588 2:98709382-98709404 TAAAAAGGGGAAAACAGGAATGG + Intronic
936619639 2:114082186-114082208 CCAGAAGGTGAAAAGGAGAAGGG - Intergenic
937270342 2:120646579-120646601 TCAAAAGATGAAATCACGCAGGG - Intergenic
938187126 2:129241304-129241326 TAAGAAGGAGACAACAGGAAAGG - Intergenic
939416122 2:141899669-141899691 TAAGAATGTGAAAACAAGAAAGG - Intronic
939784820 2:146495852-146495874 TCAGAATTTGAAAACATGTAAGG + Intergenic
940208778 2:151235110-151235132 TCAGAAGGGGACAAAATGAAAGG - Intergenic
941694654 2:168538113-168538135 ACAGAAGGGGAAAACAAGGATGG - Intronic
943683793 2:190795008-190795030 TCAGACAGTGAAAACATTAAGGG + Intergenic
944125570 2:196289140-196289162 TAAATAAGTGAAAACACGAAAGG + Intronic
944978375 2:205085645-205085667 AAAGAAGGTGAAAACCCCAATGG - Intronic
946177191 2:217929064-217929086 TCAGAAGCTGACAACAACAAGGG + Intronic
1169953206 20:11071394-11071416 TCAGAAGGAGTAAGGACGAAAGG - Intergenic
1177942072 21:27423375-27423397 TCAGGAGGTGAAAACAACCATGG - Intergenic
1179274053 21:39875083-39875105 TCAGAAAGTGAAACCAAGGAAGG + Intronic
1181371878 22:22425334-22425356 TCAGAAGGAGAAAAAAAAAAAGG - Intergenic
1182018428 22:27060640-27060662 ACAGAATGTGTAAACAGGAAGGG + Intergenic
1182164802 22:28162411-28162433 TCAGTAGATGAGAACATGAAAGG - Intronic
1182218007 22:28735520-28735542 ACTGAAGGTGAAAACCAGAATGG - Intronic
1182580582 22:31307499-31307521 TCAGAAGCATAAAACACTAAAGG - Intergenic
1184036870 22:41922586-41922608 TCAGCAGGTGAAAACCCCGAGGG - Intergenic
949730112 3:7100767-7100789 TCAGAAGGGAAACACAGGAAAGG - Intronic
950171707 3:10843354-10843376 TCAGAAGGAAAAAGCAGGAAAGG - Intronic
950663142 3:14479387-14479409 TCAGGAGTAGAAAACAAGAAGGG + Intronic
951033171 3:17905191-17905213 TCAGATGGTGAGACCCCGAAAGG - Intronic
952881947 3:37990976-37990998 CCAGCAGGTGAAAACACTGATGG + Intronic
961855183 3:129863486-129863508 TGAGAAGGTGAAAAGAAAAAGGG + Intronic
965067613 3:163872303-163872325 ACAGAAGGTGAAAACGTGCATGG + Intergenic
965323255 3:167272591-167272613 TTGGAAGGTGAAAAGAAGAATGG - Intronic
965657419 3:171002845-171002867 TCAGAAGCTTTAAACACTAAAGG - Intronic
965954158 3:174348257-174348279 GCAGAGGGTGGAAACATGAATGG + Intergenic
971245217 4:24921282-24921304 TCAGAAGGTAAAAACCTGGAAGG + Intronic
972850625 4:43045370-43045392 TCAGAAGGTGAGAATTCTAAAGG - Intergenic
973046997 4:45546604-45546626 TCAGAAGAAGAAAAAAGGAATGG + Intergenic
974238667 4:59214181-59214203 TCAGAAGTTGAAAATAGAAATGG + Intergenic
974600036 4:64066982-64067004 TCAGCAGATTAAAACACTAATGG - Intergenic
977704672 4:100058006-100058028 TCAGAAAGTAAACACACCAAAGG + Intergenic
978528018 4:109685752-109685774 TCAGAAGGGAAAAAGATGAAGGG - Intronic
980805726 4:137811084-137811106 GCAGCAGGTGAAAACTAGAAGGG + Intergenic
980838322 4:138225457-138225479 TTGGAAGCTGAAAACATGAAGGG + Intronic
980998966 4:139809659-139809681 TCAGAGGGTGAGAACACATATGG - Intronic
981289701 4:143060091-143060113 ACAGATGGTGAAGACACAAAAGG - Intergenic
982114515 4:152086667-152086689 TCAGTAGGTTAAAACAGAAAAGG + Intergenic
982464434 4:155712986-155713008 TCAGCAGGTTTAAACACAAAGGG + Intronic
984193499 4:176632124-176632146 TCAGAAGGTGAAGAAACTCATGG - Intergenic
985355579 4:189115880-189115902 TCAGGAGTTCAAAACAAGAATGG + Intergenic
986926792 5:12764309-12764331 TCAGAAGGGAAAAACATCAAAGG + Intergenic
988225462 5:28406663-28406685 TCACATGGTGAAAAGACAAAGGG - Intergenic
989248952 5:39285298-39285320 TAAGAAGGTGAAAAAGCGGATGG - Intronic
989312876 5:40041046-40041068 TCACATGGTGAAGCCACGAATGG + Intergenic
992726596 5:79613241-79613263 TCTCAAGGTGAGAACACGAAAGG + Intronic
993221479 5:85103243-85103265 TCAGAAGGTTAAGAGATGAAAGG - Intergenic
994448542 5:99909718-99909740 TCAGAGGGTGAAGAGAGGAATGG + Intergenic
994572955 5:101537215-101537237 TCAGTACATGAAAACAGGAAAGG + Intergenic
996531808 5:124534653-124534675 TCAGAAGGGGAAAAGACACAGGG - Intergenic
997244906 5:132339251-132339273 TCATAAAGTGAAAATACAAATGG - Intronic
997444348 5:133930434-133930456 AGAGAAAGTGAAAACGCGAACGG + Intergenic
997974811 5:138434642-138434664 TCAGATGGTGAAAATACTACAGG - Intronic
998466076 5:142345138-142345160 TCAGAATATGAAAACAGGCAGGG + Intergenic
1000643434 5:163733050-163733072 AAAGAAGTTGAAAACATGAAAGG - Intergenic
1000962189 5:167613006-167613028 TCAGCAGGTAAAGACACGCATGG + Intronic
1001196975 5:169682124-169682146 CCAGAAGGGGAAAAGAAGAAAGG + Intronic
1002838267 6:883840-883862 TCAGAAAGTGACAACAGGAATGG + Intergenic
1004851915 6:19708126-19708148 CCAGAAGGGGAAAACAGGATTGG - Intergenic
1005049192 6:21667496-21667518 ACAAAAGGTTAAAACACAAAAGG - Intergenic
1005393176 6:25354525-25354547 GAAGAAGCTGAAAACATGAAGGG - Intronic
1011747051 6:90416395-90416417 ACAGAAGATGAAAACCTGAATGG - Intergenic
1014666769 6:124247520-124247542 TCAGAATGTGAAAACGCTTAGGG + Intronic
1016042955 6:139451154-139451176 TCAGCAGGTGAAAAAGAGAAAGG + Intergenic
1016429998 6:143973458-143973480 TCAGAGGGAGAAAACAAGCACGG + Intronic
1016905141 6:149141000-149141022 TCAGAGTATGAAAACAGGAAAGG + Intergenic
1017684830 6:156901684-156901706 TCAAAAGGGGAAAAGACGGAGGG - Intronic
1018450304 6:163901371-163901393 TGAGAAGGAGAGAACAAGAAGGG - Intergenic
1021118046 7:16765651-16765673 TCTTAAGGAGAAAACAGGAAAGG + Intronic
1021324373 7:19247308-19247330 TCAGAAGGGGGAAACATGTAAGG + Intergenic
1022952324 7:35350906-35350928 GCAGAAGGTGAAGAAAAGAAAGG - Intergenic
1028650643 7:93146988-93147010 GCAGAGGGTGAAAACAGCAAAGG - Exonic
1029627829 7:101731417-101731439 CGAGAAGCTGAAAACAGGAATGG - Intergenic
1030965274 7:115985109-115985131 TTATAAGGTGAAAATATGAAAGG - Intronic
1030965328 7:115986277-115986299 TCCTAAGGTTAAAACAAGAATGG - Intronic
1032083273 7:128870415-128870437 TCAGAAGGTGAAGACACACGGGG - Intronic
1032728436 7:134613973-134613995 CCAGAAGAAGAAAACAGGAATGG - Intergenic
1034114111 7:148567482-148567504 TAAGAAGCTGAAAATATGAATGG - Intergenic
1035661794 8:1353775-1353797 TTAGAAGGCAAAAACACGACAGG + Intergenic
1035842791 8:2830499-2830521 TCTGAAGGAGACAACAGGAAAGG - Intergenic
1036295287 8:7529790-7529812 TCAGATTGTGAAAACAGAAAAGG - Intergenic
1036327283 8:7791228-7791250 TCAGATTGTGAAAACAGAAAAGG + Intergenic
1036516513 8:9449436-9449458 TCAGAAAGTCAAAACTAGAAGGG + Intergenic
1036807660 8:11846647-11846669 TCAGCCAGTGCAAACACGAACGG + Intronic
1037653043 8:20857976-20857998 TCAGAAGGACAAAACACAGAAGG + Intergenic
1041765878 8:61417825-61417847 TCAGAAGGAGAAACCTTGAAAGG + Intronic
1042527930 8:69784201-69784223 TTAGAAGATTAAAACACTAATGG + Intronic
1042633449 8:70845844-70845866 TCAGAAGGTAAAGAGACCAAAGG + Intergenic
1043091590 8:75911610-75911632 TTAGAAGGTGAAAAGAATAAGGG + Intergenic
1048202268 8:132384302-132384324 TCAAAAGATGAATAAACGAAAGG + Intronic
1048876578 8:138841128-138841150 TCAAAGGATGAAAACATGAATGG - Intronic
1051016502 9:12482232-12482254 TCAGAAGGTGAGATGACAAAGGG - Intergenic
1051169284 9:14302766-14302788 TCTGAAGGGGAAAAAAGGAAGGG - Intronic
1054795380 9:69296426-69296448 TCAGAAGTTAAAAATACCAACGG + Intergenic
1058159437 9:101551993-101552015 TCAGAAGATGAAAACAAAACTGG - Intronic
1058252998 9:102725491-102725513 TTAGAAGGGGAAAATAAGAAGGG + Intergenic
1186935625 X:14448010-14448032 TCATTATGTGAAAACACGGATGG - Intergenic
1187592610 X:20734886-20734908 AAAGAAGGGGAAAACACCAATGG + Intergenic
1193189838 X:78557559-78557581 TAAGAATGGGAAAACATGAAAGG - Intergenic