ID: 1132273352

View in Genome Browser
Species Human (GRCh38)
Location 15:100544997-100545019
Sequence TGAAAACACGAAGGGTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273344_1132273352 12 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273349_1132273352 -10 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273343_1132273352 20 Left 1132273343 15:100544954-100544976 CCGTGATTCCGAACCCAGCGCCT 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273341_1132273352 30 Left 1132273341 15:100544944-100544966 CCTGGGCCTTCCGTGATTCCGAA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273346_1132273352 6 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273347_1132273352 0 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273345_1132273352 7 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data
1132273342_1132273352 24 Left 1132273342 15:100544950-100544972 CCTTCCGTGATTCCGAACCCAGC 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1132273352 15:100544997-100545019 TGAAAACACGAAGGGTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273352 Original CRISPR TGAAAACACGAAGGGTCTAC AGG Intergenic
No off target data available for this crispr