ID: 1132273353

View in Genome Browser
Species Human (GRCh38)
Location 15:100545008-100545030
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273349_1132273353 1 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data
1132273344_1132273353 23 Left 1132273344 15:100544962-100544984 CCGAACCCAGCGCCTTACACAAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data
1132273347_1132273353 11 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data
1132273346_1132273353 17 Left 1132273346 15:100544968-100544990 CCAGCGCCTTACACAACCTCTTC 0: 1
1: 0
2: 3
3: 5
4: 95
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data
1132273345_1132273353 18 Left 1132273345 15:100544967-100544989 CCCAGCGCCTTACACAACCTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273353 Original CRISPR AGGGTCTACAGGCTGTTGAT AGG Intergenic
No off target data available for this crispr