ID: 1132273357

View in Genome Browser
Species Human (GRCh38)
Location 15:100545026-100545048
Sequence ATAGGAAGGGGAAGCCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273347_1132273357 29 Left 1132273347 15:100544974-100544996 CCTTACACAACCTCTTCAGAAGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1132273357 15:100545026-100545048 ATAGGAAGGGGAAGCCCTTCTGG No data
1132273349_1132273357 19 Left 1132273349 15:100544984-100545006 CCTCTTCAGAAGGTGAAAACACG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1132273357 15:100545026-100545048 ATAGGAAGGGGAAGCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273357 Original CRISPR ATAGGAAGGGGAAGCCCTTC TGG Intergenic
No off target data available for this crispr