ID: 1132273616

View in Genome Browser
Species Human (GRCh38)
Location 15:100547130-100547152
Sequence ACTTGTACGCAGGAGTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132273607_1132273616 18 Left 1132273607 15:100547089-100547111 CCTATAGTCTCAGCTACTCGGGG 0: 3
1: 270
2: 7235
3: 87951
4: 226673
Right 1132273616 15:100547130-100547152 ACTTGTACGCAGGAGTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132273616 Original CRISPR ACTTGTACGCAGGAGTTTCA AGG Intergenic
No off target data available for this crispr