ID: 1132275693

View in Genome Browser
Species Human (GRCh38)
Location 15:100561645-100561667
Sequence TAACCAGAAAAACTCAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 485}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132275693 Original CRISPR TAACCAGAAAAACTCAGAAA TGG Intronic
901408884 1:9069070-9069092 AAGCAAGATAAACTCAGAAAAGG - Intronic
901779560 1:11584491-11584513 ATATCAGAAAAACTCAGATATGG - Intergenic
902610140 1:17592383-17592405 TATCCAGAAAAGCCCAGGAAGGG - Intronic
902694413 1:18130587-18130609 TAAACTGAGGAACTCAGAAAGGG + Intronic
903313524 1:22480649-22480671 GAAAAAGAAAAACACAGAAAAGG - Intronic
903343721 1:22671261-22671283 CAACCAGGAAAACACAAAAAGGG + Intergenic
904414418 1:30348490-30348512 TAAACAGACAACCTCAGAATGGG - Intergenic
904544643 1:31259517-31259539 TAAACCTAAAAACACAGAAAAGG + Intergenic
904760705 1:32802421-32802443 TAAACTGAAAACCTCTGAAAAGG - Intronic
904899475 1:33845461-33845483 TAACCTTAAAAACTGACAAATGG + Intronic
905957125 1:42007057-42007079 TACTCAGAAAAACTCAGATTAGG - Intronic
906967201 1:50469486-50469508 TAATCAGAAGAAGTGAGAAAAGG + Intronic
908542373 1:65133708-65133730 TAACCTGATATATTCAGAAAGGG - Intergenic
908771764 1:67603815-67603837 TAACCAAAATAACTCAGGAAGGG + Intergenic
908938331 1:69402186-69402208 TAGCCAGCCAAACTCTGAAAAGG - Intergenic
908983946 1:69993992-69994014 TAAGCACAAAAACTTAGAACTGG - Intronic
909103692 1:71382030-71382052 TCATCAGAAAAAATCTGAAAAGG + Intergenic
909232987 1:73116011-73116033 TGACCATAAAAAATAAGAAAAGG - Intergenic
909604428 1:77494288-77494310 TAACCAGGATAACACAGACAAGG - Intronic
909649750 1:77960521-77960543 AAATCAGAAAAACACAGTAATGG + Intronic
909828716 1:80158510-80158532 TCACCAGAAAAACTCACACCGGG + Intergenic
911763841 1:101649168-101649190 TAACCAAATAAACACAGTAATGG - Intergenic
911997149 1:104780661-104780683 TAGCAAGAAAAAATCAGAAGGGG + Intergenic
912839836 1:113029492-113029514 AAAAAAGAAAAACTCTGAAAAGG + Intergenic
912960531 1:114191655-114191677 AAAGTAGAAAAACTCAGGAAGGG - Intergenic
913273625 1:117117855-117117877 TAGCCAGAACAAACCAGAAAGGG + Intronic
914008138 1:143751374-143751396 TAAACAGAAAATCTCAAAAGCGG - Intergenic
914838912 1:151231599-151231621 TAACAATAAAAATTCAGAAAGGG - Intronic
917236091 1:172893193-172893215 AAAAAAGAAAAACTCAGAGAGGG - Intergenic
917991677 1:180386783-180386805 AAAACAGAAAATCTCAGCAAAGG - Intronic
918862489 1:189849325-189849347 TAACCAGGAAAATTCATACAAGG - Intergenic
918935280 1:190913554-190913576 TAAAAAGAAAAAATCAGAATAGG - Intergenic
919112246 1:193235757-193235779 TAATCACAAGAACTCAGATAAGG + Intronic
919243474 1:194945824-194945846 TAACCAGAATGACTCAGGTAGGG + Intergenic
920667173 1:207971583-207971605 TAACCAGAGAAAGGGAGAAAAGG - Intergenic
922897282 1:229110055-229110077 TAACCACGAAAGCTTAGAAAAGG - Intergenic
923848832 1:237769997-237770019 CAAGGAGAAAACCTCAGAAAAGG - Intronic
924214047 1:241801213-241801235 TAAGGAGAAAAAATCAGAAATGG + Exonic
1064234926 10:13565053-13565075 TAACAAGAAAAAGCCAGAAAGGG - Intergenic
1064625632 10:17258745-17258767 GAAACAAAAAAACTCAGTAATGG + Intergenic
1064717991 10:18196911-18196933 TAGCAAGAAAAACTCAGGATGGG - Intronic
1067021669 10:42805441-42805463 TAACCAAAACAACTTTGAAAAGG - Intronic
1067423696 10:46184051-46184073 TTACCAGAAAAACTGAGAAGGGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068946553 10:62735333-62735355 CATCCAGAATCACTCAGAAATGG - Intergenic
1069329857 10:67279090-67279112 TAATCAGAAAAACTGACATATGG + Intronic
1069790465 10:71016658-71016680 TAAACAGACCAACTAAGAAATGG + Intergenic
1069948872 10:72005917-72005939 TCACCACAAAAACCAAGAAAAGG - Exonic
1070877696 10:79828433-79828455 TTACCAGGAAAACTGAGAAGGGG - Intergenic
1071366198 10:84902996-84903018 TGAGCACAAAGACTCAGAAATGG + Intergenic
1071477760 10:86039375-86039397 GGGCTAGAAAAACTCAGAAAGGG - Intronic
1071644198 10:87344477-87344499 TTACCAGGAAAACTGAGAAGGGG - Intergenic
1072763316 10:98076375-98076397 TAACCTGCAAAACACATAAAAGG + Intergenic
1073500729 10:103934479-103934501 AAACCAGAGAAACTCAGGCAAGG + Intergenic
1074046035 10:109840123-109840145 TAATCAGGAAAACTCAACAAGGG - Intergenic
1074143924 10:110700209-110700231 TAAACACAAAGACACAGAAATGG - Intronic
1075171167 10:120116189-120116211 TAAGCAGTAAAAACCAGAAACGG + Intergenic
1076072529 10:127502207-127502229 TAAATATAAAAAATCAGAAATGG + Intergenic
1076449201 10:130544639-130544661 TAACCACAAAAACACACAAATGG - Intergenic
1076653767 10:132007734-132007756 TAAACACAAAAACTCTGTAACGG + Intergenic
1078275918 11:9846397-9846419 GAACAGGAAAAACTAAGAAAAGG + Intronic
1078299360 11:10110695-10110717 TAACTAGAAAAAAACAAAAATGG + Intronic
1078988668 11:16622529-16622551 TAAGCAGAGTAACTCAGGAATGG - Intronic
1079662144 11:23052435-23052457 TACCCATAAAAATTAAGAAATGG + Intergenic
1080438942 11:32272701-32272723 TAACCCTGAAAAATCAGAAAAGG - Intergenic
1082803984 11:57435287-57435309 TAACCAGAAATACACAAAAAAGG + Intergenic
1082875307 11:57981898-57981920 TAACCTCAAAAACTGAGAGAAGG + Intergenic
1084609404 11:70192721-70192743 GAACCAGACAACTTCAGAAAAGG + Intergenic
1084804911 11:71572044-71572066 CAACCACAAAAACTTAGAATGGG - Intergenic
1085604307 11:77883464-77883486 TAAGGAAAAAGACTCAGAAAGGG + Intronic
1086005610 11:82031802-82031824 TAACCATAAAAAAGCAGGAACGG + Intergenic
1086112115 11:83210662-83210684 TAACCAGTTAAACTCTGAACTGG - Intronic
1086260555 11:84934820-84934842 TAACAAGAAAACCTAGGAAAAGG - Intronic
1087627422 11:100611888-100611910 TAACCAAAAAAAATCAGGAGTGG + Intergenic
1087736915 11:101844432-101844454 TAACCATAGAAACTAATAAAAGG - Intronic
1088719355 11:112578260-112578282 TAACCAGAAATATTCAGAAATGG + Intergenic
1088902336 11:114127702-114127724 GAGTCAGAAGAACTCAGAAAGGG + Intronic
1088938571 11:114430324-114430346 TAAGGAAAAGAACTCAGAAAAGG - Intronic
1089389595 11:118091464-118091486 AAACCAGAAAAGATCAGAGAGGG - Intronic
1089761483 11:120727707-120727729 GAAGTAGAAAAACTTAGAAATGG + Intronic
1089888161 11:121850326-121850348 AAACTAGAAAAACTCAAAATAGG - Intergenic
1090077401 11:123587965-123587987 TCATCTGAAAAACTCAGGAAGGG - Intronic
1091752162 12:3029757-3029779 TAACCAGAACAAATAACAAAAGG - Intronic
1092575939 12:9782756-9782778 AAACCAGAAAACCCCAGAAAAGG - Intergenic
1092850292 12:12619964-12619986 GAACCAGAACTACTCAGAACTGG - Intronic
1093107010 12:15099180-15099202 TAACCATAACATTTCAGAAAGGG - Intergenic
1094335222 12:29342790-29342812 TGATTAGAAAACCTCAGAAAAGG + Intronic
1095402169 12:41827410-41827432 TCACCAAAAAAATTCACAAAAGG + Intergenic
1095507891 12:42917311-42917333 TAAAAAGGAACACTCAGAAAAGG - Intergenic
1095612199 12:44143229-44143251 CAAACAGAAATACTCAGCAAAGG - Intronic
1095784952 12:46100108-46100130 TAAGCAAAGTAACTCAGAAATGG + Intergenic
1095798014 12:46241631-46241653 GTACCAGAAACAATCAGAAATGG - Intronic
1097358454 12:58629820-58629842 TGACCACAAAAACTGGGAAAAGG + Intronic
1098415804 12:70233914-70233936 TATCCACAAAAATTCATAAAAGG + Intergenic
1098462574 12:70748629-70748651 AAACCAGAGGAACACAGAAATGG + Intronic
1099926608 12:89026615-89026637 TAACCAGACAATCTCATAAGAGG + Intergenic
1099938460 12:89156566-89156588 GAAGCAGAAACACTAAGAAATGG + Intergenic
1100867866 12:98876305-98876327 TCACCAGGAAACCTGAGAAAGGG - Intronic
1101316915 12:103637624-103637646 TAGACAGAAAAACTGAGACACGG - Intronic
1101488447 12:105190130-105190152 GAACCTGAAAAATTCAGAGATGG - Exonic
1106298710 13:28442252-28442274 TAAACACAAACACTAAGAAATGG + Intronic
1106315589 13:28590625-28590647 TAACCGGGAAAACTCAGACTGGG + Intergenic
1107763291 13:43705098-43705120 TAACCTAAAAAATTCAGGAAAGG + Intronic
1108457041 13:50626671-50626693 TGAGCAGAAAAAGTTAGAAAGGG + Intronic
1108699544 13:52932278-52932300 TAAGCAGAATGACTCAGAACTGG - Intergenic
1108777687 13:53785916-53785938 GAAGCAGAAAAAATCAGCAATGG + Intergenic
1108974942 13:56429117-56429139 TAAACAGCAAGACACAGAAAGGG + Intergenic
1109229479 13:59738969-59738991 TAAAAAGAAAAATTCAAAAAGGG - Intronic
1109796005 13:67314027-67314049 TTAACAGAAAAAATCAGAAAGGG - Intergenic
1110353228 13:74536124-74536146 GAATTAGAAAAAGTCAGAAATGG - Intergenic
1110602586 13:77392264-77392286 TAATAAGAATAACTCAAAAAGGG - Intergenic
1110754258 13:79152901-79152923 TAAGCAAAATAACTCAGGAATGG - Intergenic
1110777562 13:79426574-79426596 TAGCCAGGAAAGCTCTGAAAAGG - Intergenic
1110833509 13:80058291-80058313 CAAACAAAAAAATTCAGAAAAGG - Intergenic
1111066675 13:83102632-83102654 TAACCAACCAAACTCACAAAAGG - Intergenic
1112184271 13:97113110-97113132 TAACCAGGAAATCTGAGGAAGGG - Intergenic
1112607899 13:100925972-100925994 CAACCAGAAATACACAGTAAAGG - Intergenic
1112816047 13:103274826-103274848 TAACCAGAACAGGTGAGAAAAGG - Intergenic
1113284145 13:108828301-108828323 TCACCAGGAACACTCAGAGAGGG - Intronic
1115036715 14:28866126-28866148 CAAACAAAAAGACTCAGAAAGGG + Intergenic
1115583008 14:34780803-34780825 AAACCAGAAGAATTTAGAAAAGG + Intronic
1115628321 14:35217895-35217917 TAGCCAAAACAACTTAGAAAAGG - Intronic
1116754799 14:48933780-48933802 TAACCAAACAAACTTAAAAAGGG + Intergenic
1118813154 14:69290037-69290059 TAACAAAAATAACTCAGAACAGG - Intronic
1118833295 14:69455618-69455640 TACAAAGAAAAACTCACAAAAGG - Intronic
1119154104 14:72392674-72392696 TAACAAGAAACATTCAGGAAAGG + Intronic
1119911738 14:78355773-78355795 TATCCGTAAAATCTCAGAAAAGG - Intronic
1119960661 14:78852612-78852634 TAACCAGAAATTCTAACAAAGGG - Intronic
1120301668 14:82715045-82715067 TAACTAGAAAAAGCCAGAGAGGG + Intergenic
1120602242 14:86525659-86525681 TAAAAAAAAAAACTCAGGAAAGG + Intergenic
1124796524 15:32786469-32786491 TCAGAAGAAAAAGTCAGAAAAGG + Intronic
1125120339 15:36150450-36150472 TAACAATAAACACTCTGAAAAGG + Intergenic
1125983904 15:44030607-44030629 TAACTAGGGAGACTCAGAAAGGG - Intronic
1126871259 15:52990676-52990698 AAACTATAAAAACTCTGAAAGGG - Intergenic
1127001533 15:54513836-54513858 GAAACAGAAAATCACAGAAAAGG - Intronic
1127203513 15:56686079-56686101 TAACCATTAAAACCAAGAAAAGG + Intronic
1127348380 15:58124890-58124912 TAACCATAAATACACAGAAAAGG + Intronic
1127649224 15:60990460-60990482 TAATCAGAAATGCTAAGAAATGG + Intronic
1127743559 15:61939167-61939189 TAACCACAAAATCTTTGAAAGGG + Intronic
1128011419 15:64300074-64300096 TCATCAGAAAATCTCAGAACTGG + Intronic
1128221221 15:65970024-65970046 TAATCAAAAAAACACAGAACTGG - Intronic
1128533382 15:68470586-68470608 TGACCAGAAAAACCCAGGACAGG - Intergenic
1129948357 15:79561741-79561763 TATCAAAAAAAACACAGAAAAGG + Intergenic
1130004851 15:80085507-80085529 TGACCAGAAAAGTTCAGAAGTGG - Intronic
1130071770 15:80652881-80652903 TAAGAAGAAAGCCTCAGAAAAGG - Intergenic
1130142363 15:81238650-81238672 TAAGTAAAAAAACTCATAAAGGG + Intronic
1131218447 15:90560001-90560023 TAAGAAAAAAAACTGAGAAAAGG - Intronic
1131379770 15:91954284-91954306 TATCCTGAGAAACTCACAAAGGG - Intronic
1132275693 15:100561645-100561667 TAACCAGAAAAACTCAGAAATGG + Intronic
1133558601 16:6928870-6928892 TCACCACAGAAACTTAGAAATGG + Intronic
1133998790 16:10766765-10766787 TAAACACAAAAACTCTGTAATGG - Exonic
1134584594 16:15398892-15398914 GAACCAGAAAAACTGAAAACCGG - Intronic
1135429667 16:22372838-22372860 AGACCTGAATAACTCAGAAAAGG - Intronic
1135727365 16:24866707-24866729 TAACCAGAAAAAAGCAGGAGTGG + Intronic
1138373903 16:56549272-56549294 TACCCAGTAAAGCTCAGAAGGGG - Intergenic
1138753820 16:59457599-59457621 TAACTAAATAAACTCAGAAAAGG - Intergenic
1138791216 16:59906233-59906255 TAACTAGAAAGTGTCAGAAATGG + Intergenic
1138893764 16:61177807-61177829 CAACCATAAGAACTCAGAACTGG + Intergenic
1139099696 16:63750423-63750445 TAGCTAGAAAAAAACAGAAACGG - Intergenic
1139180894 16:64747411-64747433 CAACCAGAATAAGCCAGAAAAGG + Intergenic
1139867565 16:70075105-70075127 TAACCAAAAAAATGCAGAAATGG + Intergenic
1141220369 16:82063900-82063922 TAACCACAAAAACAAAGAAAGGG + Intronic
1141591487 16:85072025-85072047 TATCCAAAAATACTCTGAAAAGG + Intronic
1142746436 17:1961241-1961263 TAACCAGGAAAAGTCACGAAGGG + Intronic
1142953196 17:3501245-3501267 TAAACAGAAAACCTCTGGAAAGG + Exonic
1144352095 17:14406328-14406350 TAAGTAGAGTAACTCAGAAATGG - Intergenic
1144994038 17:19254614-19254636 TCACCAGAAACAATCAGAAGAGG - Intronic
1145723836 17:27098606-27098628 TACACATAAAAACTCAGAACTGG + Intergenic
1146213106 17:30957205-30957227 AAGCCAGAGAACCTCAGAAAGGG + Intronic
1149854240 17:60065860-60065882 TAATAAGAAAACATCAGAAATGG - Intronic
1150464211 17:65378070-65378092 TAACCAGAGAAAATGAAAAAGGG - Intergenic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1150741716 17:67784429-67784451 TAACCAGAACAACACAGTAAAGG + Intergenic
1151270536 17:72992017-72992039 TGACCAAAAAAAATGAGAAAAGG - Intronic
1151289917 17:73142262-73142284 TCACTTGAAAAACACAGAAAAGG - Intergenic
1151504534 17:74518451-74518473 TATCCAGAAAAACTGAAAACAGG + Intergenic
1151956465 17:77382671-77382693 CCACCAGAAAACCTCAGAAAGGG + Intronic
1153329477 18:3859193-3859215 TAATCTAAAAAACACAGAAATGG + Intronic
1153548163 18:6231691-6231713 TAACAATAAACAATCAGAAAGGG - Intronic
1154487503 18:14885575-14885597 TAACAACAAAAACTCTAAAACGG - Intergenic
1155570069 18:27184092-27184114 TTATCAGAAAAACTGCGAAAAGG + Intronic
1156113070 18:33750809-33750831 CCACAGGAAAAACTCAGAAAAGG + Exonic
1156437125 18:37144287-37144309 TACCAAGACAAACTAAGAAAAGG - Intronic
1156453121 18:37277814-37277836 TTTCCAGAAAGACTTAGAAATGG + Intronic
1157842627 18:50973135-50973157 TAACAAGATAAAAACAGAAATGG - Intronic
1158654043 18:59312729-59312751 TACACAGAAAAAGGCAGAAAGGG - Exonic
1158797118 18:60860099-60860121 TAACAAGAAAAATTAAGAAAAGG + Intergenic
1159409779 18:68056478-68056500 TAACAAGAAAATCTCAAAAGAGG + Intergenic
1159662939 18:71121650-71121672 TAACTAGACAACCTAAGAAATGG - Intergenic
1159758527 18:72395600-72395622 TAACCAGAAACACAGAGGAAAGG - Intergenic
1159863831 18:73681673-73681695 TAACCAGAAAGACCCAGGACAGG - Intergenic
1160258062 18:77264449-77264471 TAAACAGAAATACTCTAAAATGG - Intronic
1160671619 19:367406-367428 TAACCAAAAAAACCCCAAAAGGG + Intronic
1163107726 19:15135658-15135680 AAACGAGAAAACTTCAGAAATGG + Intergenic
1163848409 19:19650242-19650264 TAACCTGAAACACACAGAAGGGG + Intronic
1164889795 19:31813575-31813597 AAACCTGAAAAACTATGAAAAGG - Intergenic
1166070995 19:40387788-40387810 AAAGCAGAAAAACTCAGAGAAGG - Intronic
1166206214 19:41271119-41271141 CAACCAGATACACTAAGAAAAGG - Intronic
1168445617 19:56409859-56409881 TAACCAAAAAAAAGCAAAAAAGG - Intronic
925473850 2:4191540-4191562 AAAACTGGAAAACTCAGAAATGG - Intergenic
926249405 2:11145472-11145494 TAAGCAAAAAAATGCAGAAAAGG + Exonic
927174915 2:20399107-20399129 GACCCAGAAAAGCTCACAAATGG - Intergenic
927313885 2:21659877-21659899 AAAACAGAAAAACTCAACAAAGG + Intergenic
928310451 2:30205216-30205238 TAAAGAGAAAAGGTCAGAAAGGG + Intergenic
928506674 2:31960917-31960939 CATCCAGAAAAATTCAGAAAAGG + Intronic
929160636 2:38828861-38828883 TAACCAGAAAAACTGAGGTGTGG + Intronic
929412206 2:41709626-41709648 TAAACAGAAAACCTAAGAATGGG - Intergenic
929636706 2:43529940-43529962 TAAACTGAAAAGCTCAGAACAGG + Intronic
929792035 2:45030459-45030481 TTTCCAGGAAAACTCAGAGAAGG + Intergenic
929952586 2:46426958-46426980 TAACCACAAAGACTAAGGAAAGG + Intergenic
930502520 2:52239635-52239657 TAAACATAAAAATTCACAAAAGG + Intergenic
931144265 2:59499945-59499967 AAACAAGTAAAGCTCAGAAAAGG - Intergenic
931145973 2:59518859-59518881 TAGCCAGAAATCCTCAGACATGG - Intergenic
931529309 2:63195713-63195735 TATCCAAAAAAATTAAGAAAAGG + Intronic
931817664 2:65920664-65920686 TTACCATAGGAACTCAGAAAAGG - Intergenic
931901388 2:66792327-66792349 TAAACATAAAAACTCAGTAGTGG - Intergenic
932843650 2:75111685-75111707 TTAACAGAAAAAGTCAGAATAGG + Intronic
933877047 2:86630265-86630287 AACCCAGGAAAAGTCAGAAATGG - Intronic
933899339 2:86837843-86837865 TCCACAGAAAAACACAGAAAAGG + Intronic
933987699 2:87606006-87606028 TAACCAGAAAAAAACACAAAAGG - Intergenic
934025398 2:87998142-87998164 GAACCTGAAAAGCTCAGAACTGG - Intergenic
935236447 2:101142833-101142855 TAATCAGGAAAACACAGAAGGGG + Intronic
935752268 2:106246411-106246433 TAACCAGAAAAGCACAGTACTGG + Intergenic
935781221 2:106511385-106511407 TCCACAGAAAAACACAGAAAAGG - Intergenic
935839553 2:107094467-107094489 CAAACAGAAACAATCAGAAAAGG + Intergenic
935875276 2:107499464-107499486 TATCCATATGAACTCAGAAATGG + Intergenic
935912679 2:107913954-107913976 TAACCAGAAAAGCACAGTACTGG + Intergenic
936006713 2:108895534-108895556 AAAACAGAAAAACTCAGACTTGG - Exonic
936084543 2:109457767-109457789 TGCCCAGAAAAACTCAGTGATGG + Intronic
936306141 2:111344802-111344824 TAACCAGAAAAAAACACAAAAGG + Intergenic
936443129 2:112573401-112573423 TAACTACAAAAACCCAGACATGG - Intronic
936724144 2:115291949-115291971 TAATCAGAGAAACCCAGAACTGG + Intronic
938095686 2:128460851-128460873 TAACTAAAAAAATACAGAAAAGG + Intergenic
938876158 2:135532958-135532980 TAACAAGTAAACCTCAGAAATGG - Intronic
939100483 2:137889960-137889982 TAATCAAAAGAAATCAGAAAGGG - Intergenic
939219592 2:139284639-139284661 AAACTAGAAAACCTCAGAGATGG + Intergenic
939555895 2:143673019-143673041 TATACAGAAAAATTAAGAAAAGG + Intronic
939718008 2:145609791-145609813 TAACCTGAAAAAGGCAGGAAAGG + Intergenic
939869889 2:147515289-147515311 TACAAAGAAAAACCCAGAAAGGG + Intergenic
940497681 2:154454190-154454212 TAAACAGAGAAACTAAGACAAGG - Intergenic
941325829 2:164112558-164112580 TAAGCAGAAGAATACAGAAATGG + Intergenic
941968526 2:171324645-171324667 AACCAACAAAAACTCAGAAAGGG - Intronic
942547817 2:177082945-177082967 TTACCAGCAACCCTCAGAAAAGG + Intergenic
942604747 2:177678805-177678827 TAGGCAGAGAAACTCAGAAATGG + Intronic
942760900 2:179396081-179396103 TTATCAGAGAAACACAGAAAAGG + Intergenic
942979217 2:182058826-182058848 GAACTATAAAAACTAAGAAACGG - Intronic
943285775 2:185997307-185997329 AAACTATAAAAACTCATAAAAGG + Intergenic
944220498 2:197299562-197299584 TAACTGAAATAACTCAGAAATGG + Intronic
944291296 2:198008689-198008711 TATCCAAAAGAATTCAGAAAAGG - Intronic
944470040 2:200043255-200043277 TAAAAAGAAAATCTCAGGAAAGG - Intergenic
944754145 2:202742234-202742256 TAACCAGCAAAGCTGTGAAAAGG + Intronic
945487159 2:210409881-210409903 TAAACTGAAAACCTCAGAAAAGG - Intergenic
945660025 2:212674409-212674431 TAAACAGAGAACCTCAGAATGGG - Intergenic
946150561 2:217764528-217764550 TAACCAGAAGAAGCCATAAAAGG - Intergenic
946608181 2:221429452-221429474 TACTCTGAAAGACTCAGAAAAGG + Intronic
1169272202 20:4209214-4209236 TTATGAGAAAAACACAGAAAAGG - Intergenic
1170564548 20:17590034-17590056 AAACCAAAATAAATCAGAAACGG - Intronic
1170777908 20:19394528-19394550 TAACCCAAAAAACTCAATAAAGG + Intronic
1172740408 20:37162054-37162076 AGAGGAGAAAAACTCAGAAAGGG - Intronic
1174329542 20:49807220-49807242 AAAACAGAAAAACTAAGAAGTGG - Intergenic
1175314068 20:58033807-58033829 GAATTAGAAAAACTCAGAGATGG + Intergenic
1176431477 21:6578910-6578932 AAACCAGAAAAATCCAGAGATGG - Intergenic
1176793776 21:13353759-13353781 TAACAACAAAAACTCTAAAACGG + Intergenic
1177488832 21:21794628-21794650 TAGCCAGAAACATACAGAAAAGG - Intergenic
1177788582 21:25697444-25697466 TATCCAGCAAAACCCAGAACTGG - Intronic
1178262901 21:31116445-31116467 TAACCACACACACACAGAAAAGG + Intergenic
1179706871 21:43186372-43186394 AAACCAGAAAAATCCAGAGATGG - Intergenic
1179836799 21:44040139-44040161 TAACTACAAAAACCCTGAAAAGG - Intronic
1182223801 22:28779797-28779819 TAACCAAAAAAAATCATTAATGG - Intronic
1182712025 22:32329127-32329149 GAAGCAGAAAAAAGCAGAAAAGG - Intergenic
1182928106 22:34146176-34146198 CAACAAAAAAAGCTCAGAAATGG - Intergenic
1183164200 22:36135186-36135208 TAACAAGAACAACTTAGGAATGG - Intergenic
1184125545 22:42484133-42484155 TAAACAAAAAGTCTCAGAAAGGG - Intergenic
1184307813 22:43618836-43618858 TAACCAGAAAAAATGGGAAAAGG + Intronic
949705851 3:6815852-6815874 TAACAAAGCAAACTCAGAAATGG + Intronic
950322254 3:12067610-12067632 TAACCAGAAAAAAAAAAAAAAGG + Intronic
951541048 3:23782185-23782207 TAACAACAAAAACTGAGCAAAGG + Intergenic
951714568 3:25626320-25626342 TTTCCTGAAAAACTCGGAAAAGG + Intronic
951918595 3:27828310-27828332 ACACCAGAAAAACTCACAAATGG - Intergenic
952086946 3:29834489-29834511 TAACAATAAAAACTTAGAATTGG + Intronic
952281194 3:31925073-31925095 TCACCAAAAAAACTCAGCCAAGG + Intronic
953097509 3:39793040-39793062 GAACCTGAAAAATTCAGAAAAGG + Intergenic
953104070 3:39858220-39858242 TAACCAAAAGAAATCAGGAATGG + Intronic
953668877 3:44946026-44946048 TCACCAGTGAAACTTAGAAAGGG - Intronic
954860512 3:53684957-53684979 TATCCAAAATAAGTCAGAAAAGG + Intronic
955499384 3:59569269-59569291 TAACCAAAAGAAAGCAGAAAGGG - Intergenic
955681911 3:61510758-61510780 TAGCCAAAAAAAATCAGTAAAGG - Intergenic
956115225 3:65911315-65911337 CAAGCAGAAAAAGACAGAAAAGG + Intronic
956615556 3:71168145-71168167 TAAGCAGGAAAATTCATAAAAGG - Intronic
957170874 3:76735317-76735339 TAAGCAAATAAACTCAGAAATGG + Intronic
957238292 3:77623546-77623568 TAAGAAGAAAAACTGAAAAATGG - Intronic
957274351 3:78071580-78071602 TAAACAGGAAAACTTAGCAAGGG - Intergenic
957274506 3:78073637-78073659 TAAACAGGAAAACTTAGCAAGGG - Intergenic
957501138 3:81057729-81057751 TAATCAGGAAGACTCTGAAAGGG - Intergenic
957846923 3:85749122-85749144 TAAACAGAAAATGTCAGAACAGG + Intronic
958070879 3:88609521-88609543 TAAGCAGAAAAATTTTGAAAAGG - Intergenic
958169476 3:89919867-89919889 TAACGAGAAAAACTGTGATATGG - Intergenic
958757532 3:98269074-98269096 TACACAGAAAAACACAGAATAGG - Intergenic
958880922 3:99668565-99668587 TAAGGAGAAAAACTGAGATATGG + Intronic
959520480 3:107318208-107318230 TAAACAGATAAACGTAGAAATGG + Intergenic
959991261 3:112634788-112634810 TACCCAAAAGAATTCAGAAAGGG + Intronic
960834553 3:121892288-121892310 TAACCAAACCAATTCAGAAATGG + Intergenic
962215824 3:133520666-133520688 TAGCCAGAAAAACAAAGAGAGGG + Intergenic
962464663 3:135646908-135646930 AAACCAAAAAACATCAGAAAAGG - Intergenic
962748030 3:138412003-138412025 TCCCCAGCAAAACTCAGGAATGG - Intergenic
964205364 3:154168591-154168613 AAAACAGAAAAACCCAAAAATGG + Intronic
964568172 3:158081175-158081197 TATTCAGAACACCTCAGAAAAGG + Intergenic
964849019 3:161074024-161074046 TATACAGAAAATCACAGAAAAGG + Exonic
964927460 3:161976093-161976115 TAAGCAAAAAAAATCACAAAAGG - Intergenic
967182863 3:186921682-186921704 TAACCAGACAGGCTCAGACAAGG - Intergenic
967297243 3:187976986-187977008 CAACAAGGAAAACTCTGAAAAGG + Intergenic
967482067 3:189984216-189984238 TTAACAGAAAAACTGTGAAATGG - Intronic
967556103 3:190860966-190860988 TAAAGAAAAAAAATCAGAAAAGG + Intronic
968024318 3:195426415-195426437 CAATCAGAAAAATTCAGGAAGGG + Intronic
970188798 4:13490750-13490772 TAACCAGAAAAGCACAAAAAGGG + Intergenic
970579724 4:17464202-17464224 AAAGCATAAAACCTCAGAAAGGG - Intronic
970821567 4:20221522-20221544 TAACCAGACTAACTGAAAAAAGG - Intergenic
971093432 4:23371614-23371636 CACCCAGAAAAAATTAGAAATGG + Intergenic
971536466 4:27758146-27758168 TACCCAGGAATGCTCAGAAAAGG + Intergenic
972089510 4:35263565-35263587 TAGCTAGACAAACTCAGCAAGGG - Intergenic
972855958 4:43106833-43106855 TTGCCAGAAAAACTCAGACCTGG - Intergenic
973016648 4:45147996-45148018 TAAAAAGAAAACCTCAGTAAGGG + Intergenic
973861685 4:55071136-55071158 GAATCAGAAAAACTCAAAAGTGG - Intergenic
974441590 4:61925348-61925370 TACCCAGAAAAACTGAGTAGAGG - Intronic
975223979 4:71847833-71847855 TAACCAAGAAAACTCAGAAATGG - Intergenic
975412985 4:74076437-74076459 GGACTGGAAAAACTCAGAAAGGG - Intergenic
975564564 4:75740193-75740215 TAAACAGAAATACACATAAAAGG + Intronic
976181424 4:82403070-82403092 TAAACAGAAAAAGTTAAAAATGG - Intergenic
977412242 4:96682752-96682774 TAACATGAAAAATTAAGAAATGG + Intergenic
977461710 4:97333888-97333910 TAGCCAGGAAAATTCAGCAAAGG + Intronic
978592049 4:110334796-110334818 TACCCAGGAAAACTCTGAAAAGG + Intergenic
978905794 4:114004013-114004035 TAACCAGAAAATTTTAGAATTGG - Intergenic
978948537 4:114528052-114528074 TAAACTGAAAACTTCAGAAATGG + Intergenic
978978931 4:114917673-114917695 AAAGCATAAAAACACAGAAAGGG + Intronic
979154435 4:117365293-117365315 CATCCAGAAAAACAGAGAAAGGG + Intergenic
979159282 4:117438403-117438425 TAACCACCAAAAGCCAGAAAAGG + Intergenic
979574278 4:122268537-122268559 TAGCCAGAAAAACTCAGTGGAGG - Intronic
979912275 4:126382379-126382401 TAGCCACAAAAACCCAGAAATGG + Intergenic
980254309 4:130357781-130357803 TAACCAGAAAAACACAGTGGAGG + Intergenic
980256920 4:130393557-130393579 TAACCTGAAACACCAAGAAAGGG - Intergenic
980810352 4:137869969-137869991 AAACCAAAAGAAATCAGAAAAGG + Intergenic
980867412 4:138569634-138569656 AAACCTGAAAAACCAAGAAATGG + Intergenic
981468706 4:145103688-145103710 TAGCCAGGAAAACTGAAAAAGGG - Intronic
982339040 4:154274323-154274345 TAAACAAGAAAACTCAGAATTGG - Intronic
982449665 4:155537554-155537576 TAAGTAAAACAACTCAGAAATGG - Intergenic
983597366 4:169485231-169485253 TAAACAGACAAATTCAGACATGG + Intronic
983986270 4:174063720-174063742 TAACTAGAAAAGTTCAGAGAGGG + Intergenic
985501447 5:250035-250057 TAACCAGAAATACGAAAAAAAGG + Intronic
987194297 5:15509956-15509978 TACCCAGGAAAATTCAGAGATGG - Intronic
987431978 5:17845567-17845589 TAAATAGAAACATTCAGAAATGG - Intergenic
987705874 5:21461643-21461665 TAACCATAAAATATCAGAGAAGG - Intergenic
987969507 5:24924054-24924076 TAACCATAATAACTGAGAACAGG - Intergenic
988259016 5:28859085-28859107 AAACCAGAAAGAGTCAGAACTGG - Intergenic
988285078 5:29204379-29204401 TAGCCCAAGAAACTCAGAAAGGG - Intergenic
988382246 5:30512805-30512827 TGACAAGAAAAACTTGGAAAAGG + Intergenic
988543576 5:32135726-32135748 TAATGAGATCAACTCAGAAAAGG - Intronic
989373119 5:40730796-40730818 TGCTCAGAAAAACTTAGAAATGG + Intronic
989515860 5:42342007-42342029 AAACAAAAAAAACTTAGAAATGG + Intergenic
990311865 5:54548009-54548031 AAACCAGAAAAACCCAGCAGTGG + Intergenic
990438371 5:55818367-55818389 CAACAAGAAAAACTCAAAAAGGG + Intergenic
990626429 5:57617572-57617594 CAACTTGAAAAACTCAAAAAAGG + Intergenic
990966120 5:61449944-61449966 TAACCAGAAAGACACAGAGATGG + Intronic
992335348 5:75762088-75762110 TAACCTAATATACTCAGAAAAGG - Intergenic
992860510 5:80904475-80904497 TGACCATAAGAACTCATAAATGG + Intergenic
994870378 5:105341360-105341382 TAACCAAAAGAAATCAGAAATGG - Intergenic
994933272 5:106217659-106217681 TAACCACAAAGAACCAGAAATGG - Intergenic
995453585 5:112329645-112329667 TGAACAGATAAAATCAGAAAGGG - Intronic
995653170 5:114394925-114394947 TAGCCAGGAAAATTCTGAAAAGG - Intronic
995831032 5:116356494-116356516 GACACAAAAAAACTCAGAAATGG - Intronic
995915313 5:117238818-117238840 TTAGCAGTGAAACTCAGAAAAGG - Intergenic
995973763 5:118006046-118006068 TGATGAGAAAAAATCAGAAACGG + Intergenic
996163835 5:120200221-120200243 TAATCAGAAAAATTCAGGGAGGG + Intergenic
996243817 5:121235332-121235354 TAACCAGAACACTTCAAAAAAGG + Intergenic
996801505 5:127408774-127408796 TAACCAGAAAAGCATCGAAAGGG + Intronic
996887718 5:128378097-128378119 TATCCAGTAAACCTAAGAAAGGG + Intronic
996964645 5:129293590-129293612 TAAGCAGAAAGCCTCTGAAAAGG + Intergenic
997034286 5:130169300-130169322 TATTCAGATATACTCAGAAATGG - Intronic
997045400 5:130310033-130310055 TAATCAGAAAAAAAAAGAAAAGG - Intergenic
998626110 5:143847800-143847822 TAACTAAGAAACCTCAGAAAAGG - Intergenic
998975740 5:147644849-147644871 TACCAAGGAAAATTCAGAAATGG - Exonic
1000109116 5:158090221-158090243 TGTCCAAAAAAACTCAGAAGGGG + Intergenic
1000461408 5:161523950-161523972 TAGCAAGAAAAACTAATAAAAGG + Intronic
1000641657 5:163710044-163710066 TAAGAAGAAAAAGTTAGAAAAGG + Intergenic
1000860123 5:166447373-166447395 AAACCATAAAAACTGATAAAGGG - Intergenic
1000948924 5:167456628-167456650 TAAAAAGAAATACTCTGAAATGG - Intronic
1001147392 5:169196759-169196781 GAAACAGAAAAATTAAGAAAGGG - Intronic
1001471277 5:172014735-172014757 TAACCTGATAAACTCAAAAAGGG - Intergenic
1001744154 5:174077737-174077759 GCACCAGAAAAACGCAGGAAAGG - Intronic
1001968985 5:175938599-175938621 TAAATAAAAAATCTCAGAAAAGG + Intronic
1002248458 5:177905146-177905168 TAAATAAAAAATCTCAGAAAAGG - Intergenic
1002975669 6:2073199-2073221 TAACCAGATACATTTAGAAAAGG - Intronic
1003161693 6:3640997-3641019 TAACCACAAACACTTCGAAAAGG + Intergenic
1003257093 6:4483996-4484018 CAACCCGAAAACCTCAGAGAGGG - Intergenic
1004437983 6:15615638-15615660 TAACCAGGAAGACAAAGAAATGG + Intronic
1004529664 6:16441854-16441876 TCAAGAGAAAGACTCAGAAAAGG + Intronic
1004693944 6:18016658-18016680 TATCCAGAAACTCTGAGAAAGGG - Intergenic
1005179932 6:23093551-23093573 TAACCATAAAAATTCAAAATAGG + Intergenic
1006626220 6:35399927-35399949 TAATAACAAAAAATCAGAAATGG - Intronic
1008281029 6:49596542-49596564 TAACCAGATAAATTTAAAAAAGG + Intergenic
1008378480 6:50818210-50818232 TGACCAGAAAATATTAGAAATGG + Intergenic
1008843465 6:55933926-55933948 TAACCTAAAAAATTCATAAAAGG + Intergenic
1008983071 6:57508235-57508257 CAACAACAAAAACACAGAAAGGG - Intronic
1009514894 6:64602930-64602952 CAACCAGAAAAACTCACCCAGGG - Intronic
1009623947 6:66112159-66112181 TAAACTGAAATACTCAGAAAAGG + Intergenic
1010395375 6:75386157-75386179 TGACCACAAAAACTCAGTAGAGG - Intronic
1010515393 6:76767359-76767381 TAACCAAAAAAAATCAGGATGGG - Intergenic
1010825268 6:80465279-80465301 AAACCTGAGAAACTCAGAAGGGG + Intergenic
1010881700 6:81182851-81182873 TATGAAGAAAAACTCAGCAACGG - Intergenic
1011095005 6:83651534-83651556 TAACTGGAAAATCTCAGAATAGG - Intronic
1011103330 6:83749135-83749157 AAGTCAGAAAAACTCAGAAAAGG + Intergenic
1011878923 6:91998726-91998748 TAACTAGAAAAATACAGTAAAGG - Intergenic
1012376359 6:98566262-98566284 TAACCAATAAAATTCAGAAATGG - Intergenic
1012847071 6:104403923-104403945 TAAACATGAAAAATCAGAAAAGG + Intergenic
1013891147 6:115028915-115028937 TAACTAGATTAACTAAGAAAAGG + Intergenic
1014458938 6:121671928-121671950 TAATCACTAAAATTCAGAAACGG + Intergenic
1014485496 6:121994145-121994167 CACCCAGAAAAAGTCTGAAAGGG + Intergenic
1014683686 6:124467560-124467582 TTACAAGGAAAACTCAGAGAAGG + Intronic
1014700918 6:124686706-124686728 TAACCAACAGAACACAGAAAAGG - Intronic
1014864311 6:126508907-126508929 AAACTAGAAAATCTAAGAAATGG + Intergenic
1015093124 6:129383270-129383292 CCAACAGAAAAACACAGAAAGGG + Intronic
1015456944 6:133437065-133437087 TAAACACAAAAACTTAAAAAAGG - Intronic
1015562869 6:134535582-134535604 TAACCAGAAACACACAAAAAAGG - Intergenic
1015627766 6:135198925-135198947 TAACCATGAAAACTCAGACTTGG + Exonic
1016259421 6:142150108-142150130 TAACAAGAAACTATCAGAAATGG - Intronic
1016302771 6:142650544-142650566 AAACCAGAAACTCTAAGAAAAGG - Intergenic
1016463778 6:144306128-144306150 TAACCAAAAACACAGAGAAAAGG - Intronic
1017075245 6:150611914-150611936 TCAAGAGAAAAACTCTGAAATGG + Intronic
1018337480 6:162809770-162809792 CTTCTAGAAAAACTCAGAAAGGG + Intronic
1018588412 6:165388651-165388673 TAAGCAGAGAAACAAAGAAAGGG - Intronic
1019781060 7:2939966-2939988 TGGCAAGAAACACTCAGAAAAGG + Intronic
1020692397 7:11371969-11371991 CAAGCAGAGAAAATCAGAAAGGG + Exonic
1022056401 7:26739886-26739908 TACCTTGAAAAACGCAGAAAAGG - Exonic
1022067385 7:26873222-26873244 TAACCAGAAACATGCAGAAAAGG + Intronic
1022846944 7:34219832-34219854 GAAACAGAAAATCTCAGATAAGG - Intergenic
1023074559 7:36470198-36470220 AACCCAGAAAAACACAGAAGAGG - Intergenic
1023098023 7:36682636-36682658 GAATTAGAAAAACTCAGATATGG + Intronic
1023226936 7:37979894-37979916 TGACCATAAGAACTCAGAGAAGG - Intronic
1024135362 7:46401713-46401735 TAACCAGACAAACTACAAAAAGG + Intergenic
1024204806 7:47148844-47148866 TAACCATATAATATCAGAAAAGG + Intergenic
1024838335 7:53551926-53551948 TAACATGAGAAACTCAGACATGG + Intergenic
1025114303 7:56244753-56244775 TCTCCAGAAAACCTCAGAGATGG + Intergenic
1025888948 7:65627622-65627644 TACACTGAAGAACTCAGAAATGG + Intergenic
1026447169 7:70495048-70495070 TAAACATAAAGACACAGAAATGG + Intronic
1027491295 7:78830747-78830769 GAGGCAGAAAAGCTCAGAAAAGG + Intronic
1027842788 7:83335401-83335423 ATACCAGAAAACCACAGAAAAGG + Intergenic
1028015906 7:85711801-85711823 TAAACAGCAAAACTCTGTAATGG - Intergenic
1028717751 7:93992675-93992697 TTAACAGAAATTCTCAGAAAAGG - Intronic
1029198109 7:98820638-98820660 TAACAAGACAAGCTCAGAGAAGG + Intergenic
1029555917 7:101269063-101269085 AACCCAGAAAAACTGATAAAAGG - Intergenic
1029965564 7:104736114-104736136 ATACCAGAAAAACAAAGAAAAGG + Intronic
1030446963 7:109657912-109657934 TGACAAGAAGAACTAAGAAAAGG + Intergenic
1030734442 7:113029609-113029631 TAATCAGAAAAAAACATAAAGGG - Intergenic
1030845567 7:114404958-114404980 TAATCAGAGATACACAGAAAAGG - Intronic
1030930362 7:115516193-115516215 TAACAAGAAAAACTTTAAAAGGG + Intergenic
1032727138 7:134600850-134600872 AAATCATAAAAACTGAGAAATGG + Intergenic
1032871446 7:135990333-135990355 AAAGCAGAACACCTCAGAAAAGG + Intergenic
1033396670 7:140980723-140980745 TGACCAAAAAAACTGACAAATGG - Intergenic
1033420254 7:141199169-141199191 CATGCAAAAAAACTCAGAAAAGG + Intronic
1033532711 7:142281459-142281481 TATCAAGAAAAATGCAGAAAAGG + Intergenic
1033726470 7:144123776-144123798 TATCCAGAACAACTGAGAAGGGG - Intergenic
1034592436 7:152153150-152153172 TAAACAGAAATCCTCATAAAGGG + Intronic
1036048529 8:5170249-5170271 TAACAAGAAAACCTCAGAGATGG + Intergenic
1036237914 8:7057423-7057445 TAAAAAAAAAATCTCAGAAAGGG - Intergenic
1036461641 8:8958673-8958695 TAACTAAAAAAAATTAGAAAGGG - Intergenic
1036674943 8:10823430-10823452 CAGTCAGAAAACCTCAGAAATGG + Intronic
1036836541 8:12073937-12073959 TAACCAAATTAACACAGAAACGG - Intergenic
1036858382 8:12320506-12320528 TAACCAAATTAACACAGAAACGG - Intergenic
1036967417 8:13316137-13316159 TCACCAGCAGAAATCAGAAAGGG - Intronic
1037180294 8:15996768-15996790 TAACCAGACCTACTCATAAAAGG + Intergenic
1038863034 8:31408522-31408544 TAACCAGAAAACCTGAAAGAAGG - Intergenic
1039236699 8:35509910-35509932 TAACCAGCAAACCTAAGTAAGGG - Intronic
1039364975 8:36919758-36919780 TAACCAGAAAAATGCATAATGGG + Intronic
1040717264 8:50272261-50272283 TAACCAGAAACACACAGAAAGGG - Intronic
1041667913 8:60463852-60463874 AAACCAGGAAACCTCAGAAAAGG - Intergenic
1042480435 8:69296552-69296574 GAACCAGAAATACTGGGAAAGGG - Intergenic
1042714648 8:71759494-71759516 TAACAAGAAAAGCCCAGAATTGG + Intergenic
1042841535 8:73129248-73129270 TAATCTGAAAAAGTGAGAAATGG + Intergenic
1042852569 8:73231012-73231034 TAAGCAGAAAATTACAGAAAAGG + Intergenic
1042897946 8:73691938-73691960 TCACCAGAAAAACTAAGCCATGG + Intronic
1044190522 8:89311022-89311044 TAACCAGAAAAATTGAGAAGAGG - Intergenic
1044672527 8:94697483-94697505 TAAAAAGACAAACACAGAAAAGG - Intronic
1045043741 8:98254060-98254082 TAGCCAGCAAAACTCCAAAAAGG + Exonic
1045265210 8:100613089-100613111 TAACCAGAAACAAGCAGAAAGGG + Intronic
1045522902 8:102918607-102918629 TAACCAGAAGACCTCTGAAAGGG + Intronic
1045535986 8:103028314-103028336 AAGGCAGAAAAACTCAGACAGGG + Intronic
1045598957 8:103692311-103692333 TTCCCAGACAAGCTCAGAAATGG + Intronic
1045787914 8:105944441-105944463 AAACCAGACAAGCTCAGAAGTGG + Intergenic
1046150221 8:110213789-110213811 TAAGCAGAAAAAATAACAAAAGG + Intergenic
1046404733 8:113758010-113758032 AAACCAGAAAAAGACAGGAAAGG + Intergenic
1046785630 8:118263153-118263175 CAAACAGGAAAACTAAGAAAGGG - Intronic
1047477761 8:125250815-125250837 AAAACATAAAAACTAAGAAATGG - Intronic
1050230703 9:3523377-3523399 TAATCAGAAACACTGAGAAATGG - Intronic
1050256103 9:3793716-3793738 TAGCCTGTAAAACCCAGAAAAGG - Intergenic
1050569125 9:6919460-6919482 TAAATAGAAAAACAAAGAAAAGG - Intronic
1051391724 9:16572539-16572561 TAACTTGAAAAGCTCAGGAAGGG - Intronic
1051527340 9:18060869-18060891 TTACCAGAAAATCTCAGTAATGG + Intergenic
1051870429 9:21731072-21731094 AAACCAGAAAAATGCAGGAATGG - Intergenic
1051932100 9:22398475-22398497 TAACAAGAAGAACCCAGATAAGG - Intergenic
1052575779 9:30289146-30289168 GAATCAGAGAAACTCAGTAAAGG - Intergenic
1052752612 9:32507978-32508000 TAACCAGAAAATATAGGAAAGGG - Intronic
1053620858 9:39814396-39814418 TAACAACAAAAACTCTAAAACGG - Intergenic
1054202735 9:62101276-62101298 GAACCAGAAAAAATTGGAAATGG - Intergenic
1054263304 9:62893046-62893068 TAACAACAAAAACTCTAAAACGG + Intergenic
1054635629 9:67487089-67487111 GAACCAGAAAAAATTGGAAATGG + Intergenic
1055805850 9:80092514-80092536 TAGACAGAGAGACTCAGAAAGGG + Intergenic
1055904507 9:81277183-81277205 TACCCAGAAAATCTCAGTAGAGG - Intergenic
1056309892 9:85329896-85329918 TAAGCAAAATAACTCAGGAATGG + Intergenic
1056738173 9:89227371-89227393 CAAAAAGAAAAACACAGAAAAGG + Intergenic
1059221407 9:112623882-112623904 GAACCAGAAAAAATCTGAATAGG - Intronic
1059686315 9:116640247-116640269 ACAGCAGATAAACTCAGAAATGG - Intronic
1059808020 9:117825865-117825887 TAACCATCAAGACTCAGACAAGG - Intergenic
1059929267 9:119244822-119244844 AGAACAGAAAGACTCAGAAAAGG - Intronic
1059956634 9:119522731-119522753 TGAAGAGAAAAGCTCAGAAAAGG + Intronic
1060467011 9:123915704-123915726 CAACCAGAAAAACTAAAAATAGG + Intronic
1060988676 9:127836045-127836067 TTACCAGAAAAACCCAGTCAGGG + Intronic
1062417834 9:136462150-136462172 TATCATGATAAACTCAGAAAGGG - Intronic
1187047787 X:15665072-15665094 TAACCAGAGAATCGCAGAAGGGG - Intergenic
1187128332 X:16475574-16475596 TAAGTGGAATAACTCAGAAATGG + Intergenic
1187737573 X:22320576-22320598 TAACCAGAAAGCCGCAGAGAAGG - Intergenic
1188515581 X:30981998-30982020 TAACCAGAAAAACTCAGGGAAGG + Intergenic
1188946215 X:36306037-36306059 TTGCCAGAAAAACTTTGAAAAGG - Intronic
1188978941 X:36708863-36708885 TAGCCAGAAAAAGACACAAAGGG + Intergenic
1189044163 X:37572746-37572768 TAAGATGAAAACCTCAGAAATGG + Intronic
1189190599 X:39099574-39099596 AAACCAGAAGAAGGCAGAAAAGG + Intergenic
1189453004 X:41157023-41157045 TAAGCAGAAACAATCAGAACTGG + Intronic
1190763713 X:53458528-53458550 GAAAGAGAAAAATTCAGAAATGG + Intergenic
1191172760 X:57466202-57466224 TAACTATAATAACACAGAAAAGG + Intronic
1192845109 X:74898833-74898855 TAACAAGAAACAATCAGAAAAGG + Intronic
1192922990 X:75727455-75727477 TAAACAGAATAACTACGAAATGG - Intergenic
1194003532 X:88462044-88462066 GAACCACAAAAATTCTGAAAAGG + Intergenic
1194019062 X:88665160-88665182 TAACAATAAAAATTCTGAAAAGG - Intergenic
1195108926 X:101625710-101625732 TAAACGAAAAAAGTCAGAAATGG - Exonic
1195632082 X:107067884-107067906 TAACAATAAAAACTCAAAATCGG + Intronic
1196608977 X:117689079-117689101 TAACCAGAAAAAGGAAGGAAAGG - Intergenic
1196777976 X:119358197-119358219 TAACCAGAAAAATGCTGAAAAGG + Intergenic
1197955726 X:131945545-131945567 TCATCAGAAAATGTCAGAAAAGG + Intergenic
1199810330 X:151342800-151342822 TAGAGAGAAACACTCAGAAAGGG + Intergenic
1201411752 Y:13705199-13705221 CGACCAGAAAAAAACAGAAAAGG - Intronic
1201969785 Y:19779429-19779451 CAACCAAAAAAACTCAGGACAGG + Intergenic