ID: 1132278367

View in Genome Browser
Species Human (GRCh38)
Location 15:100590470-100590492
Sequence ATGCCCTTCTAGAAGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 21, 2: 52, 3: 48, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132278367_1132278369 2 Left 1132278367 15:100590470-100590492 CCTTCAATCTTCTAGAAGGGCAT 0: 1
1: 21
2: 52
3: 48
4: 137
Right 1132278369 15:100590495-100590517 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132278367 Original CRISPR ATGCCCTTCTAGAAGATTGA AGG (reversed) Intronic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
914319774 1:146548027-146548049 ATTCCCTTCTGGAGGCTTGAGGG + Intergenic
916532367 1:165669331-165669353 ATCCCCTTCTGGAAGATACAAGG - Exonic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
916881300 1:169021924-169021946 AGGGCATTCCAGAAGATTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918880945 1:190120026-190120048 ATGCTCGTCTAGCAGTTTGAAGG - Intronic
919195394 1:194278520-194278542 AGGCCCTTCTTGAAGGTGGAGGG + Intergenic
919573315 1:199275729-199275751 AAGCCCTTGTACAATATTGATGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922728492 1:227937706-227937728 ATGCCCCTCTGGAGGCTTGAGGG - Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1069381342 10:67845731-67845753 GTGCCCTTATAAAAGGTTGAAGG - Intergenic
1071362028 10:84857681-84857703 AAACCCTTCCAGAAAATTGAAGG - Intergenic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078749248 11:14144209-14144231 ATACCCTTTTAGAAGATGGAAGG - Intronic
1080081844 11:28229566-28229588 ATGCTCTTATAAAAGATTGCAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082892303 11:58153056-58153078 ATAACATTCTAGAAGATAGAGGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1095096221 12:38150793-38150815 CTTGGCTTCTAGAAGATTGATGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097933137 12:65213185-65213207 AGGCCCTTCTAGTATATAGACGG + Intronic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1106542950 13:30706176-30706198 ATGCCTTTCTAGGAGATTGGTGG + Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1109275807 13:60302873-60302895 TTTCCCTTCTAGAAGTTTCAAGG - Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113303085 13:109044595-109044617 ATTCACTTCTAGAAAATTAATGG - Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1114919707 14:27311393-27311415 ATGCCCTTCTAGAATGCTGCAGG - Intergenic
1115451839 14:33557003-33557025 AAGCCCTTTTATAAGATTCAAGG + Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116331632 14:43604042-43604064 GTACCCTTCCAGAAGATTGGGGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG + Intergenic
1120204690 14:81574939-81574961 ATGCACTTGCAAAAGATTGAGGG + Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1126740890 15:51775069-51775091 GGGCCCTTCTGGAAGATTGAAGG + Intronic
1127278298 15:57467167-57467189 TTACCCTTCCAGGAGATTGAAGG + Intronic
1128189891 15:65682196-65682218 ATGCCCATCTAGGACTTTGATGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140013754 16:71162050-71162072 ATTCCCTTCTGGAGGCTTGAGGG - Intronic
1140280959 16:73555128-73555150 AGACTCTTCTAGAACATTGAAGG + Intergenic
1143756650 17:9072511-9072533 AAGCCCTTCAGGAAAATTGAAGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145881353 17:28355006-28355028 AGGCCCTTCTAGGATATTGTAGG - Intronic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1147670285 17:42173120-42173142 CTGCCCATCTCCAAGATTGAAGG - Intronic
1149326829 17:55539610-55539632 CTTCCCTTTTGGAAGATTGATGG + Intergenic
1152504629 17:80740371-80740393 AAGCTCTTCCAGAAGATAGAAGG + Intronic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1153422398 18:4922029-4922051 ATTCTCTTCTAGGAGATTTATGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1155738329 18:29252549-29252571 AAGGTCTTTTAGAAGATTGAAGG + Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1155969976 18:32073780-32073802 GTGACGTTCTAGATGATTGAGGG + Intergenic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162933440 19:13968654-13968676 AAGCCCATCCAGAAGATGGAAGG - Exonic
1163042299 19:14611546-14611568 ATGCCTTTCTAGAAGTTCCATGG - Intergenic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
930943566 2:57043349-57043371 ATGGCCTACCAGAAGGTTGAGGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
935914372 2:107933552-107933574 ATGCCCCTCTAAAAGATCAAGGG + Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
936682366 2:114788841-114788863 ATGCCGTTAAAAAAGATTGAAGG - Intronic
937053346 2:118910201-118910223 ATGCCCTGGTAAAACATTGAAGG + Intergenic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
939408428 2:141790879-141790901 ATACAATTCTAGAAGATTTAAGG + Intronic
940377531 2:152972383-152972405 ATGCCCTTCTAGGACATCCAGGG - Intergenic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
946097714 2:217290073-217290095 TTGCCTTTCAAGAAGATTAATGG - Intronic
1170535062 20:17332770-17332792 CTGACCTGCTAGAAGGTTGATGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177900957 21:26914504-26914526 ATTCCTTTCTAGAAGATCTAAGG + Intergenic
1179155860 21:38850650-38850672 TTGCCCTTCCAGAATTTTGAAGG + Intergenic
1180147510 21:45929529-45929551 CTGCACTTCTAGGAGATTCAAGG - Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182751030 22:32642330-32642352 TTGCCCTTCTAGAAAATGGTTGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951603158 3:24399291-24399313 ATGCCCTTCAGGTAGACTGAGGG - Intronic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952042348 3:29276477-29276499 ATGTCCTTCTTAAAGATAGAAGG + Intergenic
953437887 3:42894195-42894217 GTGCCCTTATAAAAGGTTGAAGG - Intronic
954824625 3:53361823-53361845 ATGCCCTTCTAAAAGATACTTGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959132634 3:102376317-102376339 ATGTACTTTTAGAAGATTGCTGG - Intronic
959604470 3:108227214-108227236 CTGCCATTCTAGAGGATTGTAGG + Intergenic
961406697 3:126684772-126684794 ATGCCACTCCAGAAGATTGTTGG + Intergenic
962185810 3:133258368-133258390 ATGCCCTTCTTGTAGCTTGATGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964160196 3:153637342-153637364 ATGCACATCTAGAACATTGCTGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
971677000 4:29644629-29644651 ATGCCCTTTCAGAAGTTTAAGGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
975062929 4:70025727-70025749 AGGCCATTTTAGAAGACTGATGG - Intergenic
975063007 4:70026720-70026742 AGGCCATTTTAGAAGACTGATGG + Intergenic
975064850 4:70047985-70048007 AAGCCATTTTAGAAGACTGATGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
981930332 4:150182470-150182492 CTGCCCATCTAGATGCTTGAAGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992810447 5:80382463-80382485 AGGCCCTTATAAAAGCTTGAAGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
997385651 5:133470029-133470051 ATGCCCTTCCAGAGTATGGAAGG - Intronic
997779973 5:136647181-136647203 ATTCCTATCTAGAAGATTGCAGG + Intergenic
999092658 5:148951086-148951108 AGGCCCTTCCACAAGACTGAAGG - Intronic
1000445153 5:161310151-161310173 AGGGCCTTCTAGAGGATGGAGGG + Intronic
1003423880 6:5983547-5983569 CTGCTCTTCTGGATGATTGAGGG + Intergenic
1003713021 6:8614544-8614566 ATTCCCTTCTAGAAGGTGTAGGG - Intergenic
1005347396 6:24904074-24904096 ATGCACTTGCACAAGATTGAAGG + Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006555133 6:34859381-34859403 ATCCCCTTGAAGAACATTGAGGG + Exonic
1006672898 6:35740729-35740751 ATGCCCTGCTAGAATATGCAAGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1008881555 6:56385365-56385387 ATTCCTTTCTGGAAGCTTGAGGG + Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016940553 6:149479903-149479925 ATGCCATTCAATAAGATTGGGGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021115600 7:16743211-16743233 ATTTCCTGCTAGAAGTTTGAGGG - Intergenic
1022862184 7:34378950-34378972 ATGCCCACCTAGAAAGTTGAAGG + Intergenic
1023957135 7:44895349-44895371 AGGCCCTTCTGGAAGGTTCAGGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028425749 7:90686543-90686565 ATGACCTTGTTGAAAATTGAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030533791 7:110741452-110741474 GTGCCCTTATAGAAGATCCAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034892866 7:154855913-154855935 TTCCCCTTCTTGAAAATTGATGG + Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1039888050 8:41666669-41666691 ATGCCCTTGAAGGTGATTGATGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044914500 8:97098101-97098123 AGGGCCTCCTAGTAGATTGATGG + Intronic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1048627606 8:136202913-136202935 ATGCCCTTCTATAAAATTACCGG - Intergenic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1051160524 9:14202468-14202490 ATCCCATTATAGAATATTGATGG + Intronic
1051310010 9:15759599-15759621 TTGGCCTTCTTGAAGATTGCAGG + Intronic
1051835580 9:21334350-21334372 ATCCACTTCTATAAGATTGTAGG + Exonic
1054832249 9:69638788-69638810 GTGCCCATTCAGAAGATTGATGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1058866309 9:109165346-109165368 ATGTCCTTGTTCAAGATTGAGGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187794861 X:22992873-22992895 ATGCCCTTTTTGTAGAATGATGG - Intergenic
1188563160 X:31493244-31493266 ATGTCCTTCAAGAAGATTTTTGG - Intronic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1192882725 X:75304249-75304271 ATTCCTTCCTAGAGGATTGATGG - Exonic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196554609 X:117071442-117071464 CTTCACTTCTAGAAGATTTAAGG - Intergenic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic