ID: 1132285327

View in Genome Browser
Species Human (GRCh38)
Location 15:100658401-100658423
Sequence ACAGGGGCACCCATGTGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132285327_1132285335 25 Left 1132285327 15:100658401-100658423 CCGCCGCACATGGGTGCCCCTGT No data
Right 1132285335 15:100658449-100658471 CTGCTGAGCTTGCCGACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132285327 Original CRISPR ACAGGGGCACCCATGTGCGG CGG (reversed) Intergenic
No off target data available for this crispr