ID: 1132285335

View in Genome Browser
Species Human (GRCh38)
Location 15:100658449-100658471
Sequence CTGCTGAGCTTGCCGACGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132285330_1132285335 8 Left 1132285330 15:100658418-100658440 CCCTGTGATAGTTCCCGAGCATC No data
Right 1132285335 15:100658449-100658471 CTGCTGAGCTTGCCGACGTCAGG No data
1132285331_1132285335 7 Left 1132285331 15:100658419-100658441 CCTGTGATAGTTCCCGAGCATCT No data
Right 1132285335 15:100658449-100658471 CTGCTGAGCTTGCCGACGTCAGG No data
1132285333_1132285335 -6 Left 1132285333 15:100658432-100658454 CCGAGCATCTGCCTGCTCTGCTG No data
Right 1132285335 15:100658449-100658471 CTGCTGAGCTTGCCGACGTCAGG No data
1132285329_1132285335 9 Left 1132285329 15:100658417-100658439 CCCCTGTGATAGTTCCCGAGCAT No data
Right 1132285335 15:100658449-100658471 CTGCTGAGCTTGCCGACGTCAGG No data
1132285327_1132285335 25 Left 1132285327 15:100658401-100658423 CCGCCGCACATGGGTGCCCCTGT No data
Right 1132285335 15:100658449-100658471 CTGCTGAGCTTGCCGACGTCAGG No data
1132285328_1132285335 22 Left 1132285328 15:100658404-100658426 CCGCACATGGGTGCCCCTGTGAT No data
Right 1132285335 15:100658449-100658471 CTGCTGAGCTTGCCGACGTCAGG No data
1132285332_1132285335 -5 Left 1132285332 15:100658431-100658453 CCCGAGCATCTGCCTGCTCTGCT No data
Right 1132285335 15:100658449-100658471 CTGCTGAGCTTGCCGACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132285335 Original CRISPR CTGCTGAGCTTGCCGACGTC AGG Intergenic