ID: 1132286210

View in Genome Browser
Species Human (GRCh38)
Location 15:100664707-100664729
Sequence GAAGCACCTGGCCATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132286210_1132286214 0 Left 1132286210 15:100664707-100664729 CCTTCCACATGGCCAGGTGCTTC No data
Right 1132286214 15:100664730-100664752 TCCAGAAATACAACAGGAACAGG No data
1132286210_1132286213 -6 Left 1132286210 15:100664707-100664729 CCTTCCACATGGCCAGGTGCTTC No data
Right 1132286213 15:100664724-100664746 TGCTTCTCCAGAAATACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132286210 Original CRISPR GAAGCACCTGGCCATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr