ID: 1132286646

View in Genome Browser
Species Human (GRCh38)
Location 15:100668427-100668449
Sequence CAGAGGAGGGGGCTTCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132286634_1132286646 9 Left 1132286634 15:100668395-100668417 CCCGGCTCTGTGTGAGGGCACAG No data
Right 1132286646 15:100668427-100668449 CAGAGGAGGGGGCTTCCGCCTGG No data
1132286635_1132286646 8 Left 1132286635 15:100668396-100668418 CCGGCTCTGTGTGAGGGCACAGG No data
Right 1132286646 15:100668427-100668449 CAGAGGAGGGGGCTTCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132286646 Original CRISPR CAGAGGAGGGGGCTTCCGCC TGG Intergenic
No off target data available for this crispr