ID: 1132288822

View in Genome Browser
Species Human (GRCh38)
Location 15:100685286-100685308
Sequence ACTCATCTAGAAAGGCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132288822_1132288830 18 Left 1132288822 15:100685286-100685308 CCTCTTTGCCTTTCTAGATGAGT No data
Right 1132288830 15:100685327-100685349 TACTCAGAAAGGAGGGCGGAAGG No data
1132288822_1132288826 10 Left 1132288822 15:100685286-100685308 CCTCTTTGCCTTTCTAGATGAGT No data
Right 1132288826 15:100685319-100685341 TAGTTTCCTACTCAGAAAGGAGG No data
1132288822_1132288825 7 Left 1132288822 15:100685286-100685308 CCTCTTTGCCTTTCTAGATGAGT No data
Right 1132288825 15:100685316-100685338 TCATAGTTTCCTACTCAGAAAGG No data
1132288822_1132288828 14 Left 1132288822 15:100685286-100685308 CCTCTTTGCCTTTCTAGATGAGT No data
Right 1132288828 15:100685323-100685345 TTCCTACTCAGAAAGGAGGGCGG No data
1132288822_1132288827 11 Left 1132288822 15:100685286-100685308 CCTCTTTGCCTTTCTAGATGAGT No data
Right 1132288827 15:100685320-100685342 AGTTTCCTACTCAGAAAGGAGGG No data
1132288822_1132288831 19 Left 1132288822 15:100685286-100685308 CCTCTTTGCCTTTCTAGATGAGT No data
Right 1132288831 15:100685328-100685350 ACTCAGAAAGGAGGGCGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132288822 Original CRISPR ACTCATCTAGAAAGGCAAAG AGG (reversed) Intergenic
No off target data available for this crispr