ID: 1132288823

View in Genome Browser
Species Human (GRCh38)
Location 15:100685294-100685316
Sequence AGGCTGAAACTCATCTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132288823_1132288827 3 Left 1132288823 15:100685294-100685316 CCTTTCTAGATGAGTTTCAGCCT No data
Right 1132288827 15:100685320-100685342 AGTTTCCTACTCAGAAAGGAGGG No data
1132288823_1132288831 11 Left 1132288823 15:100685294-100685316 CCTTTCTAGATGAGTTTCAGCCT No data
Right 1132288831 15:100685328-100685350 ACTCAGAAAGGAGGGCGGAAGGG No data
1132288823_1132288826 2 Left 1132288823 15:100685294-100685316 CCTTTCTAGATGAGTTTCAGCCT No data
Right 1132288826 15:100685319-100685341 TAGTTTCCTACTCAGAAAGGAGG No data
1132288823_1132288830 10 Left 1132288823 15:100685294-100685316 CCTTTCTAGATGAGTTTCAGCCT No data
Right 1132288830 15:100685327-100685349 TACTCAGAAAGGAGGGCGGAAGG No data
1132288823_1132288825 -1 Left 1132288823 15:100685294-100685316 CCTTTCTAGATGAGTTTCAGCCT No data
Right 1132288825 15:100685316-100685338 TCATAGTTTCCTACTCAGAAAGG No data
1132288823_1132288828 6 Left 1132288823 15:100685294-100685316 CCTTTCTAGATGAGTTTCAGCCT No data
Right 1132288828 15:100685323-100685345 TTCCTACTCAGAAAGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132288823 Original CRISPR AGGCTGAAACTCATCTAGAA AGG (reversed) Intergenic
No off target data available for this crispr