ID: 1132288824

View in Genome Browser
Species Human (GRCh38)
Location 15:100685314-100685336
Sequence TTTCTGAGTAGGAAACTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132288824_1132288831 -9 Left 1132288824 15:100685314-100685336 CCTCATAGTTTCCTACTCAGAAA No data
Right 1132288831 15:100685328-100685350 ACTCAGAAAGGAGGGCGGAAGGG No data
1132288824_1132288830 -10 Left 1132288824 15:100685314-100685336 CCTCATAGTTTCCTACTCAGAAA No data
Right 1132288830 15:100685327-100685349 TACTCAGAAAGGAGGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132288824 Original CRISPR TTTCTGAGTAGGAAACTATG AGG (reversed) Intergenic
No off target data available for this crispr