ID: 1132288825

View in Genome Browser
Species Human (GRCh38)
Location 15:100685316-100685338
Sequence TCATAGTTTCCTACTCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132288823_1132288825 -1 Left 1132288823 15:100685294-100685316 CCTTTCTAGATGAGTTTCAGCCT No data
Right 1132288825 15:100685316-100685338 TCATAGTTTCCTACTCAGAAAGG No data
1132288821_1132288825 8 Left 1132288821 15:100685285-100685307 CCCTCTTTGCCTTTCTAGATGAG No data
Right 1132288825 15:100685316-100685338 TCATAGTTTCCTACTCAGAAAGG No data
1132288822_1132288825 7 Left 1132288822 15:100685286-100685308 CCTCTTTGCCTTTCTAGATGAGT No data
Right 1132288825 15:100685316-100685338 TCATAGTTTCCTACTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132288825 Original CRISPR TCATAGTTTCCTACTCAGAA AGG Intergenic
No off target data available for this crispr