ID: 1132295079

View in Genome Browser
Species Human (GRCh38)
Location 15:100728806-100728828
Sequence TTCCCAGCACAAGCCCTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132295075_1132295079 15 Left 1132295075 15:100728768-100728790 CCTTGCTGGTGCTTGCTTTGTGA No data
Right 1132295079 15:100728806-100728828 TTCCCAGCACAAGCCCTACGTGG No data
1132295073_1132295079 26 Left 1132295073 15:100728757-100728779 CCACCACTGTGCCTTGCTGGTGC No data
Right 1132295079 15:100728806-100728828 TTCCCAGCACAAGCCCTACGTGG No data
1132295074_1132295079 23 Left 1132295074 15:100728760-100728782 CCACTGTGCCTTGCTGGTGCTTG No data
Right 1132295079 15:100728806-100728828 TTCCCAGCACAAGCCCTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132295079 Original CRISPR TTCCCAGCACAAGCCCTACG TGG Intergenic
No off target data available for this crispr