ID: 1132298983

View in Genome Browser
Species Human (GRCh38)
Location 15:100764918-100764940
Sequence GAGAAGGAGGAAAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132298983_1132298993 10 Left 1132298983 15:100764918-100764940 CCGGCCTCCTTTTCCTCCTTCTC No data
Right 1132298993 15:100764951-100764973 GTATAAAGAATGAAGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132298983 Original CRISPR GAGAAGGAGGAAAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr