ID: 1132300552

View in Genome Browser
Species Human (GRCh38)
Location 15:100772971-100772993
Sequence TTCAATTAGCTTGAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132300552_1132300556 9 Left 1132300552 15:100772971-100772993 CCTTCCCTCTCAAGCTAATTGAA No data
Right 1132300556 15:100773003-100773025 AAAAAGTACTTAAAGAGGCCTGG No data
1132300552_1132300555 4 Left 1132300552 15:100772971-100772993 CCTTCCCTCTCAAGCTAATTGAA No data
Right 1132300555 15:100772998-100773020 AAAAAAAAAAGTACTTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132300552 Original CRISPR TTCAATTAGCTTGAGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr