ID: 1132302766

View in Genome Browser
Species Human (GRCh38)
Location 15:100786805-100786827
Sequence ATGTGGATATGGAGAGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132302757_1132302766 28 Left 1132302757 15:100786754-100786776 CCTTACAAGAAAAAGAGATTAGG No data
Right 1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132302766 Original CRISPR ATGTGGATATGGAGAGAGGG CGG Intergenic
No off target data available for this crispr