ID: 1132306382

View in Genome Browser
Species Human (GRCh38)
Location 15:100817168-100817190
Sequence TAGTTTTATGTTTTACATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132306382_1132306387 6 Left 1132306382 15:100817168-100817190 CCTACATGTAAAACATAAAACTA No data
Right 1132306387 15:100817197-100817219 TAGGAACTGGGCTGCACAGCAGG No data
1132306382_1132306389 16 Left 1132306382 15:100817168-100817190 CCTACATGTAAAACATAAAACTA No data
Right 1132306389 15:100817207-100817229 GCTGCACAGCAGGAGGTGAGTGG No data
1132306382_1132306385 -6 Left 1132306382 15:100817168-100817190 CCTACATGTAAAACATAAAACTA No data
Right 1132306385 15:100817185-100817207 AAACTAGCCTGTTAGGAACTGGG No data
1132306382_1132306384 -7 Left 1132306382 15:100817168-100817190 CCTACATGTAAAACATAAAACTA No data
Right 1132306384 15:100817184-100817206 AAAACTAGCCTGTTAGGAACTGG No data
1132306382_1132306390 20 Left 1132306382 15:100817168-100817190 CCTACATGTAAAACATAAAACTA No data
Right 1132306390 15:100817211-100817233 CACAGCAGGAGGTGAGTGGCAGG No data
1132306382_1132306388 9 Left 1132306382 15:100817168-100817190 CCTACATGTAAAACATAAAACTA No data
Right 1132306388 15:100817200-100817222 GAACTGGGCTGCACAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132306382 Original CRISPR TAGTTTTATGTTTTACATGT AGG (reversed) Intergenic